Incidental Mutation 'R5911:Trim37'
ID461011
Institutional Source Beutler Lab
Gene Symbol Trim37
Ensembl Gene ENSMUSG00000018548
Gene Nametripartite motif-containing 37
SynonymsMUL, 1110032A10Rik, 2810004E07Rik, TEF3
MMRRC Submission 044108-MU
Accession Numbers

Genbank: NM_197987

Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87127077-87220683 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87196837 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 34 (Y34*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041282]
Predicted Effect probably null
Transcript: ENSMUST00000041282
AA Change: Y591*
SMART Domains Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548
AA Change: Y591*

DomainStartEndE-ValueType
RING 15 54 1.71e-1 SMART
BBOX 90 132 7.32e-12 SMART
BBC 132 254 3.05e-31 SMART
MATH 281 384 1.51e-13 SMART
low complexity region 494 504 N/A INTRINSIC
low complexity region 516 529 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152637
Predicted Effect probably null
Transcript: ENSMUST00000154138
AA Change: Y34*
SMART Domains Protein: ENSMUSP00000118260
Gene: ENSMUSG00000018548
AA Change: Y34*

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Meta Mutation Damage Score 0.586 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Gene trapped(7)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Trim37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Trim37 APN 11 87186393 missense probably damaging 1.00
IGL01372:Trim37 APN 11 87184946 missense probably benign 0.00
IGL01510:Trim37 APN 11 87177860 missense probably damaging 1.00
IGL02055:Trim37 APN 11 87166649 missense probably benign 0.44
IGL02106:Trim37 APN 11 87201404 nonsense probably null
IGL02251:Trim37 APN 11 87167430 splice site probably benign
IGL02498:Trim37 APN 11 87185050 missense probably benign
IGL02836:Trim37 APN 11 87196959 missense probably benign 0.01
IGL03089:Trim37 APN 11 87190137 missense probably damaging 1.00
IGL03302:Trim37 APN 11 87147001 missense possibly damaging 0.89
IGL03347:Trim37 APN 11 87201621 missense possibly damaging 0.80
G5030:Trim37 UTSW 11 87143141 missense probably damaging 0.96
R0396:Trim37 UTSW 11 87146968 missense probably damaging 1.00
R0544:Trim37 UTSW 11 87145502 nonsense probably null
R0946:Trim37 UTSW 11 87146955 missense probably damaging 0.99
R1481:Trim37 UTSW 11 87129759 nonsense probably null
R1799:Trim37 UTSW 11 87178019 missense probably damaging 1.00
R1851:Trim37 UTSW 11 87218306 missense probably damaging 1.00
R2107:Trim37 UTSW 11 87159825 missense probably benign 0.04
R3878:Trim37 UTSW 11 87206002 missense probably benign 0.10
R4049:Trim37 UTSW 11 87140603 critical splice donor site probably null
R4224:Trim37 UTSW 11 87216463 missense probably damaging 1.00
R4486:Trim37 UTSW 11 87196825 missense probably benign 0.31
R5244:Trim37 UTSW 11 87218257 missense probably benign 0.10
R5343:Trim37 UTSW 11 87137603 missense probably damaging 0.98
R5417:Trim37 UTSW 11 87166679 missense probably damaging 1.00
R5894:Trim37 UTSW 11 87201440 missense probably damaging 0.99
R5957:Trim37 UTSW 11 87145551 missense probably damaging 1.00
R6159:Trim37 UTSW 11 87216548 critical splice donor site probably null
R6479:Trim37 UTSW 11 87216487 nonsense probably null
R6527:Trim37 UTSW 11 87190084 missense probably damaging 1.00
R7021:Trim37 UTSW 11 87167509 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCCAGGTTGTGTATACATATAC -3'
(R):5'- TTTACCTGTGGGCTGCAACAG -3'

Sequencing Primer
(F):5'- TTCTGGGTAGTAACAAGGCCC -3'
(R):5'- CTGTGGGCTGCAACAGTGAAG -3'
Posted On2017-02-28