Incidental Mutation 'R5911:Klhdc1'
ID461017
Institutional Source Beutler Lab
Gene Symbol Klhdc1
Ensembl Gene ENSMUSG00000051890
Gene Namekelch domain containing 1
Synonyms
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69241176-69284632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69256251 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 187 (E187G)
Ref Sequence ENSEMBL: ENSMUSP00000134180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063445] [ENSMUST00000173419]
Predicted Effect probably benign
Transcript: ENSMUST00000063445
AA Change: E187G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068046
Gene: ENSMUSG00000051890
AA Change: E187G

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.4e-11 PFAM
Pfam:Kelch_4 67 122 4.4e-7 PFAM
Pfam:Kelch_6 67 124 1.7e-7 PFAM
Pfam:Kelch_3 79 125 1.8e-8 PFAM
Pfam:Kelch_3 170 205 2.5e-7 PFAM
Pfam:Kelch_2 196 235 2.8e-8 PFAM
Pfam:Kelch_1 196 236 1.4e-6 PFAM
Pfam:Kelch_4 196 245 5.5e-7 PFAM
Pfam:Kelch_3 206 256 3.9e-8 PFAM
Pfam:Kelch_4 247 295 5.3e-10 PFAM
Pfam:Kelch_3 258 307 1.7e-7 PFAM
low complexity region 364 376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173419
AA Change: E187G

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134180
Gene: ENSMUSG00000051890
AA Change: E187G

DomainStartEndE-ValueType
Pfam:Kelch_5 11 54 4.7e-11 PFAM
Pfam:Kelch_4 67 123 1.7e-8 PFAM
Pfam:Kelch_6 67 124 5.6e-8 PFAM
Pfam:Kelch_1 68 116 3.2e-6 PFAM
Pfam:Kelch_3 78 126 3.1e-9 PFAM
Pfam:Kelch_3 165 205 2.8e-8 PFAM
Pfam:Kelch_5 193 237 2.7e-6 PFAM
Pfam:Kelch_2 196 235 1.8e-8 PFAM
Pfam:Kelch_6 196 237 2.6e-8 PFAM
Pfam:Kelch_4 196 245 2e-7 PFAM
Pfam:Kelch_3 206 256 2.1e-7 PFAM
Pfam:Kelch_5 245 285 2.4e-6 PFAM
Pfam:Kelch_4 247 299 3.5e-11 PFAM
Pfam:Kelch_6 247 299 3.2e-8 PFAM
Pfam:Kelch_3 258 301 1.2e-7 PFAM
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Klhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Klhdc1 APN 12 69242008 missense possibly damaging 0.92
IGL01432:Klhdc1 APN 12 69251977 missense probably damaging 0.97
IGL02086:Klhdc1 APN 12 69283184 missense probably benign 0.18
IGL02212:Klhdc1 APN 12 69250766 missense probably damaging 1.00
IGL02548:Klhdc1 APN 12 69253718 missense probably benign 0.00
IGL02861:Klhdc1 APN 12 69251451 missense possibly damaging 0.85
R0446:Klhdc1 UTSW 12 69283308 missense probably benign
R0656:Klhdc1 UTSW 12 69258030 missense probably benign
R1528:Klhdc1 UTSW 12 69263198 missense probably benign 0.02
R3001:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R3002:Klhdc1 UTSW 12 69256209 missense possibly damaging 0.91
R4428:Klhdc1 UTSW 12 69268226 intron probably benign
R4738:Klhdc1 UTSW 12 69283133 missense probably benign 0.07
R5009:Klhdc1 UTSW 12 69251938 missense possibly damaging 0.89
R5366:Klhdc1 UTSW 12 69283150 missense probably damaging 0.99
R5619:Klhdc1 UTSW 12 69258145 intron probably null
R5662:Klhdc1 UTSW 12 69283165 missense probably benign 0.07
R5995:Klhdc1 UTSW 12 69250774 missense probably damaging 1.00
R6708:Klhdc1 UTSW 12 69259530 missense possibly damaging 0.75
R6992:Klhdc1 UTSW 12 69253757 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTTGTATATGGTGCCTGTAA -3'
(R):5'- GAGAGACGGAGAGCCATTTT -3'

Sequencing Primer
(F):5'- GTATATGGTGCCTGTAACTTTATGAG -3'
(R):5'- GACGGAGAGCCATTTTTACATGC -3'
Posted On2017-02-28