Incidental Mutation 'R5911:Mlh3'
ID461019
Institutional Source Beutler Lab
Gene Symbol Mlh3
Ensembl Gene ENSMUSG00000021245
Gene NamemutL homolog 3
Synonyms
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85234520-85270599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85268455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 319 (V319D)
Ref Sequence ENSEMBL: ENSMUSP00000152840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008966] [ENSMUST00000019378] [ENSMUST00000117138] [ENSMUST00000121930] [ENSMUST00000166821] [ENSMUST00000220854] [ENSMUST00000223230]
Predicted Effect probably benign
Transcript: ENSMUST00000008966
SMART Domains Protein: ENSMUSP00000008966
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019378
AA Change: V319D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019378
Gene: ENSMUSG00000021245
AA Change: V319D

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117138
SMART Domains Protein: ENSMUSP00000113161
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 1 98 6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121930
SMART Domains Protein: ENSMUSP00000112609
Gene: ENSMUSG00000008822

DomainStartEndE-ValueType
Pfam:Acylphosphatase 64 156 4.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166821
AA Change: V319D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129900
Gene: ENSMUSG00000021245
AA Change: V319D

DomainStartEndE-ValueType
HATPase_c 17 125 1.04e0 SMART
DNA_mis_repair 211 349 8.78e-22 SMART
low complexity region 582 594 N/A INTRINSIC
low complexity region 658 671 N/A INTRINSIC
low complexity region 863 882 N/A INTRINSIC
low complexity region 1078 1096 N/A INTRINSIC
MutL_C 1153 1334 7.45e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220854
AA Change: V319D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000223230
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Both oocytes and spermatocytes exhibit meiotic block and die. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Mlh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Mlh3 APN 12 85267929 missense probably benign
IGL01462:Mlh3 APN 12 85266736 missense probably benign
IGL01961:Mlh3 APN 12 85266344 missense probably benign 0.00
IGL02596:Mlh3 APN 12 85240958 critical splice donor site probably null
IGL03008:Mlh3 APN 12 85240851 missense probably benign 0.23
IGL03142:Mlh3 APN 12 85250301 critical splice donor site probably null
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0032:Mlh3 UTSW 12 85245749 intron probably benign
R0078:Mlh3 UTSW 12 85268818 missense probably damaging 0.98
R0129:Mlh3 UTSW 12 85266140 splice site probably benign
R0269:Mlh3 UTSW 12 85268405 missense probably benign 0.00
R0393:Mlh3 UTSW 12 85267587 nonsense probably null
R0403:Mlh3 UTSW 12 85268968 missense possibly damaging 0.93
R0409:Mlh3 UTSW 12 85240854 missense possibly damaging 0.95
R0587:Mlh3 UTSW 12 85266419 missense probably benign 0.00
R0701:Mlh3 UTSW 12 85267903 missense probably benign 0.00
R0718:Mlh3 UTSW 12 85247697 missense possibly damaging 0.86
R0883:Mlh3 UTSW 12 85235714 missense possibly damaging 0.89
R0989:Mlh3 UTSW 12 85269395 missense probably benign 0.22
R0990:Mlh3 UTSW 12 85267765 missense probably benign
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1467:Mlh3 UTSW 12 85237600 nonsense probably null
R1562:Mlh3 UTSW 12 85266920 missense probably benign 0.14
R1599:Mlh3 UTSW 12 85268369 missense probably damaging 1.00
R1694:Mlh3 UTSW 12 85267141 missense probably damaging 1.00
R1777:Mlh3 UTSW 12 85268754 missense possibly damaging 0.75
R1822:Mlh3 UTSW 12 85266145 splice site probably benign
R1874:Mlh3 UTSW 12 85237513 critical splice donor site probably null
R1914:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R1915:Mlh3 UTSW 12 85261668 missense probably benign 0.08
R2075:Mlh3 UTSW 12 85269141 nonsense probably null
R2083:Mlh3 UTSW 12 85269041 missense probably benign 0.16
R2267:Mlh3 UTSW 12 85260811 missense possibly damaging 0.55
R2334:Mlh3 UTSW 12 85268077 missense probably benign 0.00
R2882:Mlh3 UTSW 12 85267566 missense probably damaging 1.00
R3623:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3624:Mlh3 UTSW 12 85268395 missense probably damaging 1.00
R3963:Mlh3 UTSW 12 85268680 missense possibly damaging 0.94
R4376:Mlh3 UTSW 12 85259198 missense probably benign 0.00
R5334:Mlh3 UTSW 12 85245761 critical splice donor site probably null
R5526:Mlh3 UTSW 12 85269373 nonsense probably null
R5556:Mlh3 UTSW 12 85268493 nonsense probably null
R5611:Mlh3 UTSW 12 85267445 missense probably benign 0.21
R6050:Mlh3 UTSW 12 85240846 missense possibly damaging 0.89
R6221:Mlh3 UTSW 12 85268418 missense possibly damaging 0.94
R6377:Mlh3 UTSW 12 85268497 missense probably damaging 0.97
R6820:Mlh3 UTSW 12 85247723 missense probably damaging 1.00
R6826:Mlh3 UTSW 12 85245824 missense probably benign 0.38
R6992:Mlh3 UTSW 12 85235720 missense probably damaging 1.00
R7217:Mlh3 UTSW 12 85266707 missense probably benign
R7228:Mlh3 UTSW 12 85235656 missense probably benign 0.07
X0024:Mlh3 UTSW 12 85247669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGTCGTGCCAAACAAAC -3'
(R):5'- AATTTGAGTTCAGTGGCTACATCAG -3'

Sequencing Primer
(F):5'- GAGTCGTGCCAAACAAACTAAAAC -3'
(R):5'- GCAGTTTTTGTTTGTGAACAGAAGAC -3'
Posted On2017-02-28