Incidental Mutation 'R5911:Slc30a5'
ID461022
Institutional Source Beutler Lab
Gene Symbol Slc30a5
Ensembl Gene ENSMUSG00000021629
Gene Namesolute carrier family 30 (zinc transporter), member 5
SynonymsZntl1, Znt5, 1810010K08Rik, ZTL1, ZnT-5
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100802648-100833427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100809092 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 527 (N527S)
Ref Sequence ENSEMBL: ENSMUSP00000153587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067246] [ENSMUST00000225922]
Predicted Effect probably damaging
Transcript: ENSMUST00000067246
AA Change: N584S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065764
Gene: ENSMUSG00000021629
AA Change: N584S

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
transmembrane domain 56 75 N/A INTRINSIC
transmembrane domain 96 113 N/A INTRINSIC
transmembrane domain 128 145 N/A INTRINSIC
transmembrane domain 150 164 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
transmembrane domain 235 254 N/A INTRINSIC
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 341 360 N/A INTRINSIC
Pfam:Cation_efflux 417 645 1.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225129
Predicted Effect probably damaging
Transcript: ENSMUST00000225922
AA Change: N527S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC30A/ZnT family of zinc transporter proteins. ZnT proteins mediate both cellular zinc efflux and zinc sequestration into membrane-bound organelles. The encoded protein plays a role in the early secretory pathway as a heterodimer with zinc transporter 6, and may also regulate zinc sequestration into secretory granules of pancreatic beta cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice are growth retarded and exhibit skeletal defects including reduced bone density. The majority of mutant male mice die suddenly when they reach reproductive age due to bradyarrhythmia, whereas female mice live a normal term. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Slc30a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Slc30a5 APN 13 100806666 missense probably damaging 1.00
IGL01647:Slc30a5 APN 13 100821145 missense possibly damaging 0.66
IGL02338:Slc30a5 APN 13 100803433 missense probably damaging 0.99
IGL02408:Slc30a5 APN 13 100813724 missense probably damaging 1.00
IGL02582:Slc30a5 APN 13 100812647 critical splice donor site probably null
IGL02987:Slc30a5 APN 13 100803915 missense probably damaging 1.00
IGL03025:Slc30a5 APN 13 100813887 missense probably damaging 0.99
IGL03064:Slc30a5 APN 13 100811310 missense probably damaging 1.00
IGL03089:Slc30a5 APN 13 100813830 missense probably benign 0.01
IGL03268:Slc30a5 APN 13 100806703 missense probably damaging 1.00
R0083:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0108:Slc30a5 UTSW 13 100803400 missense probably damaging 1.00
R0153:Slc30a5 UTSW 13 100826494 missense possibly damaging 0.46
R0542:Slc30a5 UTSW 13 100809285 splice site probably null
R0601:Slc30a5 UTSW 13 100814770 intron probably benign
R1125:Slc30a5 UTSW 13 100803413 missense probably damaging 1.00
R1434:Slc30a5 UTSW 13 100803442 missense probably damaging 0.98
R1673:Slc30a5 UTSW 13 100813383 missense probably benign 0.13
R1762:Slc30a5 UTSW 13 100813462 missense probably damaging 1.00
R1974:Slc30a5 UTSW 13 100813953 missense probably benign 0.06
R2082:Slc30a5 UTSW 13 100806533 critical splice donor site probably null
R2151:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2152:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R2153:Slc30a5 UTSW 13 100803949 missense probably damaging 1.00
R3899:Slc30a5 UTSW 13 100818147 missense probably benign 0.18
R4009:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4010:Slc30a5 UTSW 13 100809233 missense probably damaging 1.00
R4270:Slc30a5 UTSW 13 100829013 missense probably benign 0.04
R4815:Slc30a5 UTSW 13 100813710 missense probably damaging 1.00
R5048:Slc30a5 UTSW 13 100806741 missense probably damaging 1.00
R5450:Slc30a5 UTSW 13 100821172 missense possibly damaging 0.81
R5638:Slc30a5 UTSW 13 100813872 nonsense probably null
R5892:Slc30a5 UTSW 13 100813302 missense probably damaging 1.00
R6453:Slc30a5 UTSW 13 100814689 missense probably benign 0.00
R6769:Slc30a5 UTSW 13 100813860 missense probably benign 0.19
R6795:Slc30a5 UTSW 13 100817069 missense probably damaging 1.00
R7224:Slc30a5 UTSW 13 100809254 missense probably damaging 0.99
R7305:Slc30a5 UTSW 13 100811424 missense probably damaging 0.98
R7318:Slc30a5 UTSW 13 100813969 missense probably benign 0.13
X0019:Slc30a5 UTSW 13 100813842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACGTGCAGCTTGTCATTG -3'
(R):5'- AGGGCTGATAGTAAACCTTATTGG -3'

Sequencing Primer
(F):5'- CTCAAACAGAGTTGATCACTGCGTG -3'
(R):5'- GGTATCTGTGCCTTCAGCCAC -3'
Posted On2017-02-28