Incidental Mutation 'R5911:Jrk'
ID461025
Institutional Source Beutler Lab
Gene Symbol Jrk
Ensembl Gene ENSMUSG00000046380
Gene Namejerky
Synonyms
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R5911 (G1)
Quality Score179
Status Validated
Chromosome15
Chromosomal Location74702301-74709535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74705768 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 556 (D556G)
Ref Sequence ENSEMBL: ENSMUSP00000051842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050234
AA Change: D556G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051842
Gene: ENSMUSG00000046380
AA Change: D556G

DomainStartEndE-ValueType
Pfam:CENP-B_N 14 66 5.3e-27 PFAM
CENPB 83 149 8.82e-24 SMART
Pfam:DDE_1 213 382 2.2e-46 PFAM
low complexity region 395 405 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056711
SMART Domains Protein: ENSMUSP00000060582
Gene: ENSMUSG00000044276

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185751
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is similar to DNA-binding proteins, such as major centromere autoantigen B (CENPB). Inactivation of the related gene in mice resulted in epileptic seizures. Childhood Absence Epilepsy (CAE) has been mapped to the same chromosomal location (8q24.3) as this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Heterozygous mutants show whole body jerks, clonic seizures and epileptic brain activity. Homozygous mutants show elevated seizure susceptibility, impaired postnatal growth, reduced life span, male sterility and impaired female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Jrk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0144:Jrk UTSW 15 74706156 missense probably benign 0.01
R1871:Jrk UTSW 15 74706563 missense possibly damaging 0.91
R3417:Jrk UTSW 15 74706885 missense probably damaging 0.96
R4867:Jrk UTSW 15 74707220 missense probably benign 0.00
R5294:Jrk UTSW 15 74707336 missense possibly damaging 0.88
R5769:Jrk UTSW 15 74706068 missense probably benign 0.19
R6123:Jrk UTSW 15 74706680 missense possibly damaging 0.46
R6176:Jrk UTSW 15 74706340 missense possibly damaging 0.47
Z1088:Jrk UTSW 15 74707394 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGTAAACAAGGAGCAACCCTG -3'
(R):5'- CATCCTTTGAGGCACTTGTGC -3'

Sequencing Primer
(F):5'- GGAGCAACCCTGACAAGAGC -3'
(R):5'- CCGTGTTTCAGCGTGCAAGAG -3'
Posted On2017-02-28