Incidental Mutation 'R5911:Dgcr6'
ID461028
Institutional Source Beutler Lab
Gene Symbol Dgcr6
Ensembl Gene ENSMUSG00000003531
Gene NameDiGeorge syndrome critical region gene 6
Synonyms
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5911 (G1)
Quality Score86
Status Validated
Chromosome16
Chromosomal Location18052860-18071632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18066734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 82 (D82G)
Ref Sequence ENSEMBL: ENSMUSP00000123053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003620] [ENSMUST00000066027] [ENSMUST00000076757] [ENSMUST00000136776] [ENSMUST00000139861] [ENSMUST00000143343] [ENSMUST00000151266] [ENSMUST00000153123] [ENSMUST00000155387]
Predicted Effect probably benign
Transcript: ENSMUST00000003620
SMART Domains Protein: ENSMUSP00000003620
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Pfam:Pro_dh 119 578 7.7e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066027
AA Change: D50G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067682
Gene: ENSMUSG00000003531
AA Change: D50G

DomainStartEndE-ValueType
Pfam:DGCR6 1 198 4e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076757
AA Change: D22G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076044
Gene: ENSMUSG00000003531
AA Change: D22G

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123969
Predicted Effect probably benign
Transcript: ENSMUST00000136776
SMART Domains Protein: ENSMUSP00000117597
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
Pfam:Pro_dh 159 479 1.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139861
SMART Domains Protein: ENSMUSP00000123223
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143343
AA Change: D22G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123029
Gene: ENSMUSG00000003531
AA Change: D22G

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148514
Predicted Effect possibly damaging
Transcript: ENSMUST00000151266
AA Change: D50G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122572
Gene: ENSMUSG00000003531
AA Change: D50G

DomainStartEndE-ValueType
Pfam:DGCR6 1 195 3.1e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153123
SMART Domains Protein: ENSMUSP00000118954
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 3 163 9.6e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155387
AA Change: D82G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123053
Gene: ENSMUSG00000003531
AA Change: D82G

DomainStartEndE-ValueType
Pfam:DGCR6 2 41 1.6e-10 PFAM
Pfam:DGCR6 59 230 9.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160746
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: This gene encodes a protein that is similar to the gonadal protein in Drosophila (fruit fly). The encoded protein is thought to play a role in migration of neural crest cells during development. Deletions in the human gene are associated with DiGeorge syndrome (or velocardiofacial syndrome) which has many clinical features including cardiac abnormalities, cleft palate, atypical facial features, hypocalcemia, hypoparathyroidism and defective development or congenital absence of the thymus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Dgcr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02481:Dgcr6 APN 16 18065174 missense possibly damaging 0.89
IGL02483:Dgcr6 APN 16 18065174 missense possibly damaging 0.89
R3841:Dgcr6 UTSW 16 18070213 nonsense probably null
R4837:Dgcr6 UTSW 16 18066846 missense possibly damaging 0.79
R7322:Dgcr6 UTSW 16 18070907 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCAGCACTACAGAGCCTG -3'
(R):5'- AGAAGTTTCTGGACAGCAGAC -3'

Sequencing Primer
(F):5'- GCACTACAGAGCCTGGTCAAG -3'
(R):5'- CTAAAAGGATCAGCATGGCTCTGC -3'
Posted On2017-02-28