Incidental Mutation 'R5911:Lrch3'
ID461031
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms2210409B11Rik, LOC385628
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5911 (G1)
Quality Score200
Status Validated
Chromosome16
Chromosomal Location32914100-33015647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32959463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 111 (Y111H)
Ref Sequence ENSEMBL: ENSMUSP00000130009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000164486] [ENSMUST00000165616] [ENSMUST00000170201] [ENSMUST00000170899]
Predicted Effect probably damaging
Transcript: ENSMUST00000023491
AA Change: Y237H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133399
Predicted Effect probably damaging
Transcript: ENSMUST00000135193
AA Change: Y237H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156928
Predicted Effect probably benign
Transcript: ENSMUST00000164486
SMART Domains Protein: ENSMUSP00000131416
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165616
AA Change: Y111H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801
AA Change: Y111H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170201
AA Change: Y237H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170899
AA Change: Y237H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32994965 missense probably benign 0.10
IGL01400:Lrch3 APN 16 32979541 missense probably damaging 1.00
IGL02565:Lrch3 APN 16 33005714 missense probably benign 0.00
IGL03076:Lrch3 APN 16 32981853 missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32952137 missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32914277 missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32955324 missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32995852 intron probably benign
R0123:Lrch3 UTSW 16 32961754 splice site probably benign
R0225:Lrch3 UTSW 16 32961754 splice site probably benign
R0326:Lrch3 UTSW 16 32979500 missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32986880 missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32997483 nonsense probably null
R1204:Lrch3 UTSW 16 33009214 missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32988495 splice site probably benign
R1526:Lrch3 UTSW 16 32950376 missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32950411 nonsense probably null
R1850:Lrch3 UTSW 16 32986793 missense probably benign 0.01
R1966:Lrch3 UTSW 16 32914385 missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32995841 missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32961675 missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32950396 missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32988484 splice site probably null
R4795:Lrch3 UTSW 16 33005704 missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32914397 missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32975807 missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32985965 unclassified probably null
R5470:Lrch3 UTSW 16 32998590 missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32914184 missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32998526 missense probably damaging 1.00
R5862:Lrch3 UTSW 16 32995809 missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32975736 missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32994997 critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32950420 missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32993779 missense probably benign 0.05
R7197:Lrch3 UTSW 16 32990295 missense probably damaging 1.00
R7319:Lrch3 UTSW 16 32994993 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTATTCCTGTCTCTAAGCAATCAG -3'
(R):5'- CAGCAGCAGTGGTATTGGTG -3'

Sequencing Primer
(F):5'- GTGATTGTTCCTTCCACTG -3'
(R):5'- TGGTATTGGTGAATGGCAAGAC -3'
Posted On2017-02-28