Incidental Mutation 'R5911:Spast'
ID461034
Institutional Source Beutler Lab
Gene Symbol Spast
Ensembl Gene ENSMUSG00000024068
Gene Namespastin
SynonymsSpg4
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74338987-74391115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74387063 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 571 (S571T)
Ref Sequence ENSEMBL: ENSMUSP00000024869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024869] [ENSMUST00000224711]
Predicted Effect probably benign
Transcript: ENSMUST00000024869
AA Change: S571T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024869
Gene: ENSMUSG00000024068
AA Change: S571T

DomainStartEndE-ValueType
low complexity region 3 46 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 90 113 N/A INTRINSIC
MIT 114 192 4.33e-18 SMART
AAA 372 508 7.59e-17 SMART
low complexity region 513 520 N/A INTRINSIC
Pfam:Vps4_C 560 610 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224711
AA Change: S570T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene are sterile and display progressive axonopathy with focal axonal swellings and late onset gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Spast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Spast APN 17 74372339 splice site probably benign
R0671:Spast UTSW 17 74339451 splice site probably benign
R1170:Spast UTSW 17 74381968 critical splice acceptor site probably null
R1698:Spast UTSW 17 74356160 nonsense probably null
R2076:Spast UTSW 17 74352031 missense probably damaging 1.00
R4334:Spast UTSW 17 74352015 missense probably damaging 1.00
R4765:Spast UTSW 17 74369216 missense probably damaging 1.00
R5002:Spast UTSW 17 74369226 nonsense probably null
R6073:Spast UTSW 17 74373305 missense probably damaging 1.00
R6183:Spast UTSW 17 74373358 missense probably damaging 0.99
R6450:Spast UTSW 17 74368840 missense probably benign 0.01
R6819:Spast UTSW 17 74367286 missense possibly damaging 0.47
R6821:Spast UTSW 17 74351962 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAAGAGATGGGGTGCCTAC -3'
(R):5'- TTTACACTGCTGAGGGCCAG -3'

Sequencing Primer
(F):5'- TGTAGAACAGGCTGCCTTGAACTC -3'
(R):5'- CTGAGGGCCAGACACAATGC -3'
Posted On2017-02-28