Incidental Mutation 'R0565:Olfr1189'
ID46106
Institutional Source Beutler Lab
Gene Symbol Olfr1189
Ensembl Gene ENSMUSG00000068808
Gene Nameolfactory receptor 1189
SynonymsGA_x6K02T2Q125-50079044-50079964, MOR237-2
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0565 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88586454-88592762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88592009 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 68 (D68E)
Ref Sequence ENSEMBL: ENSMUSP00000149696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090700] [ENSMUST00000213679]
Predicted Effect probably benign
Transcript: ENSMUST00000090700
AA Change: D68E

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088201
Gene: ENSMUSG00000068808
AA Change: D68E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.6e-42 PFAM
Pfam:7tm_1 39 285 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213679
AA Change: D68E

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Olfr1189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Olfr1189 APN 2 88592606 missense probably benign 0.22
R0115:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0481:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R1106:Olfr1189 UTSW 2 88592011 missense probably benign 0.01
R1501:Olfr1189 UTSW 2 88592148 missense possibly damaging 0.94
R1616:Olfr1189 UTSW 2 88592008 missense probably damaging 0.99
R1763:Olfr1189 UTSW 2 88592436 missense probably benign 0.02
R1847:Olfr1189 UTSW 2 88592172 missense probably damaging 1.00
R1989:Olfr1189 UTSW 2 88592599 missense probably damaging 0.99
R3436:Olfr1189 UTSW 2 88592104 missense probably damaging 1.00
R3500:Olfr1189 UTSW 2 88591941 missense probably damaging 1.00
R4410:Olfr1189 UTSW 2 88592421 missense probably benign 0.03
R4463:Olfr1189 UTSW 2 88592632 missense possibly damaging 0.77
R5005:Olfr1189 UTSW 2 88592004 missense probably benign 0.00
R5174:Olfr1189 UTSW 2 88592648 missense probably damaging 1.00
R5557:Olfr1189 UTSW 2 88592553 missense probably damaging 1.00
R6354:Olfr1189 UTSW 2 88592134 missense probably damaging 1.00
R6850:Olfr1189 UTSW 2 88592306 nonsense probably null
R7522:Olfr1189 UTSW 2 88592661 missense not run
Predicted Primers PCR Primer
(F):5'- CCCACAAGGCTGTGAAATCACTCATTC -3'
(R):5'- GCGACATAGCGATCATAGGCCATAAC -3'

Sequencing Primer
(F):5'- CAGAGTTTATTCTGTTGGGAGTTAC -3'
(R):5'- CGATCATAGGCCATAACAATGAG -3'
Posted On2013-06-11