Incidental Mutation 'R5912:Ust'
ID461065
Institutional Source Beutler Lab
Gene Symbol Ust
Ensembl Gene ENSMUSG00000047712
Gene Nameuronyl-2-sulfotransferase
SynonymsUA2OST, D930010O20Rik
MMRRC Submission 044109-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5912 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location8204756-8518825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8298061 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 227 (Y227H)
Ref Sequence ENSEMBL: ENSMUSP00000052017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061601]
Predicted Effect probably benign
Transcript: ENSMUST00000061601
AA Change: Y227H

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052017
Gene: ENSMUSG00000047712
AA Change: Y227H

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 53 317 8.5e-11 PFAM
Pfam:Sulfotransfer_2 98 359 6.4e-38 PFAM
low complexity region 385 398 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219116
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Uronyl 2-sulfotransferase transfers sulfate to the 2-position of uronyl residues, such as iduronyl residues in dermatan sulfate and glucuronyl residues in chondroitin sulfate (Kobayashi et al., 1999 [PubMed 10187838]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,696 C166S possibly damaging Het
Ahnak T A 19: 9,011,903 M3517K probably damaging Het
Asap2 T C 12: 21,206,343 V214A probably damaging Het
Atp13a4 A G 16: 29,456,571 V365A probably benign Het
Bivm G T 1: 44,126,413 G8* probably null Het
Cc2d2a A C 5: 43,720,430 D1043A probably damaging Het
Cdh2 A C 18: 16,640,450 I331S possibly damaging Het
Clip3 A C 7: 30,298,870 D247A probably benign Het
Csf3r A T 4: 126,029,960 I88F probably damaging Het
Cyp2j13 A T 4: 96,056,842 N316K probably damaging Het
Dnah12 T A 14: 26,770,008 C1133* probably null Het
Glud1 G A 14: 34,311,343 probably null Het
Gm5805 A G 15: 81,972,817 noncoding transcript Het
Gsg1l2 G T 11: 67,774,714 probably null Het
Ikzf1 C A 11: 11,748,464 S105* probably null Het
Kif18b A G 11: 102,912,991 S448P probably benign Het
Klhl31 C A 9: 77,655,730 N592K probably damaging Het
Kmt2c A G 5: 25,347,469 F1239L possibly damaging Het
Lama5 A G 2: 180,195,475 Y1014H probably damaging Het
Macf1 A C 4: 123,397,158 L3980R probably damaging Het
Magi1 A T 6: 93,708,145 S524T possibly damaging Het
Nlrp4f A T 13: 65,194,908 Y308N probably damaging Het
Olfr393 A C 11: 73,847,675 I150R possibly damaging Het
Olfr402 A T 11: 74,155,220 E22V possibly damaging Het
Rfx5 G A 3: 94,958,718 probably benign Het
Scn1b C T 7: 31,117,803 V165M probably damaging Het
Sema4c A C 1: 36,554,388 V41G possibly damaging Het
Serpini1 G T 3: 75,616,607 G174V probably benign Het
Sh2b1 T C 7: 126,471,470 E353G probably damaging Het
Slc7a6 G T 8: 106,179,657 V174L probably benign Het
Smg1 A T 7: 118,154,586 probably benign Het
Spag9 A G 11: 94,044,425 N21D probably damaging Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Sulf1 A G 1: 12,786,752 probably benign Het
Swt1 A G 1: 151,411,409 S111P probably damaging Het
Syne2 G A 12: 75,908,947 probably null Het
Tanc1 T C 2: 59,791,686 V383A possibly damaging Het
Tbc1d10b G T 7: 127,199,861 A491E probably damaging Het
Tek A G 4: 94,798,640 T132A probably damaging Het
Traf3 A G 12: 111,255,349 I290V probably benign Het
Traf5 A G 1: 191,998,069 probably benign Het
Ttn A T 2: 76,810,343 I13687N probably damaging Het
Unc5c A G 3: 141,789,006 D415G probably damaging Het
Vmn2r100 A G 17: 19,531,809 N705D probably damaging Het
Wnk2 T C 13: 49,060,774 E1444G probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb5 A G 4: 44,993,750 S545P probably benign Het
Zfp710 A G 7: 80,081,474 D133G probably benign Het
Zfp866 A T 8: 69,766,284 C229S probably benign Het
Other mutations in Ust
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Ust APN 10 8298078 missense probably benign 0.09
IGL03056:Ust APN 10 8207562 missense probably benign 0.01
R0015:Ust UTSW 10 8330065 splice site probably benign
R0417:Ust UTSW 10 8245936 missense probably damaging 1.00
R0423:Ust UTSW 10 8298148 missense probably damaging 1.00
R0533:Ust UTSW 10 8248080 splice site probably benign
R1344:Ust UTSW 10 8298190 missense possibly damaging 0.82
R1436:Ust UTSW 10 8307438 missense probably damaging 1.00
R1803:Ust UTSW 10 8298055 critical splice donor site probably null
R2059:Ust UTSW 10 8207566 missense probably damaging 1.00
R4248:Ust UTSW 10 8518218 missense possibly damaging 0.67
R4811:Ust UTSW 10 8245941 missense probably damaging 0.97
R5075:Ust UTSW 10 8518224 missense probably damaging 0.97
R5950:Ust UTSW 10 8248101 missense probably benign 0.33
R7302:Ust UTSW 10 8518209 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGTAAGCTCCCAACCTG -3'
(R):5'- GGGTGAGTCCTAACAATCTCC -3'

Sequencing Primer
(F):5'- CGTGACACAGCTGGAGTTATCAC -3'
(R):5'- GTGAGTCCTAACAATCTCCCTGTTTG -3'
Posted On2017-02-28