Incidental Mutation 'R5912:Traf3'
ID461075
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
Accession Numbers
Stock #R5912 (G1)
Quality Score214
Status Not validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111255349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 290 (I290V)
Ref Sequence ENSEMBL: ENSMUSP00000058361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
Predicted Effect probably benign
Transcript: ENSMUST00000021706
AA Change: I315V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: I315V

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: I290V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: I290V

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: I290V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: I290V

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells.
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,696 C115* probably null Het
Ahnak T A 19: 9,011,903 M3517K probably damaging Het
Asap2 T C 12: 21,206,343 V214A probably damaging Het
Atp13a4 A G 16: 29,456,571 V365A probably benign Het
Bivm G T 1: 44,126,413 G8* probably null Het
Cc2d2a A C 5: 43,720,430 D1043A probably damaging Het
Cdh2 A C 18: 16,640,450 I331S possibly damaging Het
Clip3 A C 7: 30,298,870 D247A probably benign Het
Csf3r A T 4: 126,029,960 I88F probably damaging Het
Cyp2j13 A T 4: 96,056,842 N375K probably damaging Het
Dnah12 T A 14: 26,770,008 C1133* probably null Het
Glud1 G A 14: 34,311,343 probably null Het
Gm12302 G T 11: 67,774,714 R36L probably damaging Het
Gm355 C T 2: 128,596,074 R245* probably null Het
Gm5805 A G 15: 81,972,817 K143R noncoding transcript Het
Ikzf1 C A 11: 11,748,464 S125* probably null Het
Kif18b A G 11: 102,912,991 S448P probably benign Het
Klhl31 C A 9: 77,655,730 N592K probably damaging Het
Kmt2c A G 5: 25,347,469 F1239L possibly damaging Het
Lama5 A G 2: 180,195,475 Y1014H probably damaging Het
Lcp2 A G 11: 34,089,665 D173G noncoding transcript Het
Macf1 A C 4: 123,397,158 L3980R probably damaging Het
Magi1 A T 6: 93,708,145 S751T possibly damaging Het
Nlrp4f A T 13: 65,194,908 Y308N probably damaging Het
Olfr393 A C 11: 73,847,675 I150R possibly damaging Het
Olfr402 A T 11: 74,155,220 E22V possibly damaging Het
Rfx5 G A 3: 94,958,718 V443I unknown Het
Scn1b C T 7: 31,117,803 V165M probably damaging Het
Sema4c A C 1: 36,554,388 V41G possibly damaging Het
Serpini1 G T 3: 75,616,607 G174V probably benign Het
Sh2b1 T C 7: 126,471,470 E353G probably damaging Het
Slc7a6 G T 8: 106,179,657 V174L probably benign Het
Smg1 A T 7: 118,154,586 M2512K possibly damaging Het
Spag9 A G 11: 94,044,425 N21D probably damaging Het
Sulf1 A G 1: 12,786,752 E172G noncoding transcript Het
Swt1 A G 1: 151,411,409 S111P probably damaging Het
Tanc1 T C 2: 59,791,686 V383A possibly damaging Het
Tbc1d10b G T 7: 127,199,861 A491E probably damaging Het
Tek A G 4: 94,798,640 T132A probably damaging Het
Traf5 A G 1: 191,998,069 S184P noncoding transcript Het
Ttn A T 2: 76,810,343 I13687N probably damaging Het
Unc5c A G 3: 141,789,006 D415G probably damaging Het
Ust A G 10: 8,298,061 Y227H probably benign Het
Vmn2r100 A G 17: 19,531,809 N768D probably damaging Het
Wnk2 T C 13: 49,060,774 E1444G probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb5 A G 4: 44,993,750 S545P probably benign Het
Zfp710 A G 7: 80,081,474 D133G probably benign Het
Zfp866 A T 8: 69,766,284 C229S probably benign Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
han UTSW 12 111261576 missense
Hulk UTSW 12 111261576 missense probably damaging 1.00
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4621:Traf3 UTSW 12 111260786 missense noncoding transcript
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGGGCTCCTTTTAAGATGCC -3'
(R):5'- ACATCGCATCTTTAAGCTTCAC -3'

Sequencing Primer
(F):5'- GGCTCCTTTTAAGATGCCAGTAG -3'
(R):5'- AAGCTTCACCTGCTCCAGTGAG -3'
Posted OnFeb 28, 2017