Incidental Mutation 'R5914:Birc3'
List |< first << previous [record 91 of 958] next >> last >|
ID461205
Institutional Source Beutler Lab
Gene Symbol Birc3
Ensembl Gene ENSMUSG00000032000
Gene Namebaculoviral IAP repeat-containing 3
SynonymsApi2, cIAP2, cIAP-2, HIAP2, IAP2, MIAP2, MIHC, RNF49
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7848699-7873186 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to C at 7857342 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamic Acid at position 377 (*377E)
Ref Sequence ENSEMBL: ENSMUSP00000111336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013949] [ENSMUST00000115672] [ENSMUST00000115673] [ENSMUST00000159323]
Predicted Effect probably benign
Transcript: ENSMUST00000013949
SMART Domains Protein: ENSMUSP00000013949
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
CARD 438 525 7.29e-4 SMART
RING 555 589 1.43e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115672
AA Change: *377E
SMART Domains Protein: ENSMUSP00000111336
Gene: ENSMUSG00000032000
AA Change: *377E

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
BIR 167 237 2.12e-36 SMART
BIR 253 324 1.5e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115673
SMART Domains Protein: ENSMUSP00000111337
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159323
SMART Domains Protein: ENSMUSP00000125652
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
BIR 27 98 1.92e-34 SMART
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161642
SMART Domains Protein: ENSMUSP00000125512
Gene: ENSMUSG00000032000

DomainStartEndE-ValueType
SCOP:d1g73d_ 4 35 1e-6 SMART
PDB:3T6P|A 4 106 2e-39 PDB
low complexity region 107 125 N/A INTRINSIC
Meta Mutation Damage Score 0.6408 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced susceptibility to endotoxic shock. Mice homozygous for a knock-in allele exhibit increased B cell survival and proliferation, lymph node hyperplasia, lymphocytic infiltrates in the lungs, and enlarged gut-associated lympoid tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Birc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Birc3 APN 9 7860732 missense probably damaging 1.00
IGL02852:Birc3 APN 9 7854483 missense probably damaging 0.99
IGL03135:Birc3 APN 9 7849721
R0478:Birc3 UTSW 9 7860347 missense probably damaging 1.00
R0905:Birc3 UTSW 9 7851051 makesense probably null
R1934:Birc3 UTSW 9 7854499 missense possibly damaging 0.89
R2005:Birc3 UTSW 9 7860341 missense probably damaging 1.00
R3019:Birc3 UTSW 9 7857389 critical splice donor site probably null
R4169:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R4964:Birc3 UTSW 9 7860552 missense probably benign 0.01
R5338:Birc3 UTSW 9 7857359 missense probably benign 0.01
R5395:Birc3 UTSW 9 7861174 missense probably damaging 1.00
R5877:Birc3 UTSW 9 7849346 missense probably damaging 1.00
R6148:Birc3 UTSW 9 7849683 missense possibly damaging 0.78
R6471:Birc3 UTSW 9 7857420 missense probably benign 0.00
R6747:Birc3 UTSW 9 7860261 critical splice donor site probably null
R6752:Birc3 UTSW 9 7857344 missense probably benign 0.10
R6812:Birc3 UTSW 9 7854417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTATGAGGCCTGAAGCATAAAC -3'
(R):5'- AAATGGAGCAGGTCTGTTGG -3'

Sequencing Primer
(F):5'- AAATTTCTCCAAGCGGGCTG -3'
(R):5'- GTCATTTTCAGTGCAGTGCTAG -3'
Posted On2017-02-28