Incidental Mutation 'R5915:A2m'
ID461254
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5915 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121667163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 940 (V940E)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably damaging
Transcript: ENSMUST00000032203
AA Change: V940E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: V940E

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,385 probably null Het
Alox12e T C 11: 70,318,224 I399V possibly damaging Het
Apoa5 C A 9: 46,269,309 Q42K probably damaging Het
Arfgap1 A G 2: 180,978,422 Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 probably null Het
Arl16 G A 11: 120,466,605 probably benign Het
Atp8b5 A G 4: 43,370,577 D951G probably damaging Het
Babam2 T A 5: 31,785,611 L80Q probably damaging Het
Celsr1 C T 15: 85,937,975 V1714I probably benign Het
Celsr1 C T 15: 86,030,349 R1141H probably damaging Het
Cep295 A G 9: 15,341,479 L351P probably damaging Het
Dlc1 T A 8: 36,938,675 probably benign Het
Dpy30 G T 17: 74,315,911 D25E probably benign Het
Drosha T C 15: 12,935,066 W998R probably damaging Het
Fibp A G 19: 5,463,616 D220G possibly damaging Het
Grm3 C T 5: 9,511,927 C641Y probably damaging Het
Gulo A T 14: 66,008,121 V8D probably benign Het
Ifrd1 A T 12: 40,213,096 C164S possibly damaging Het
Jam2 G A 16: 84,809,407 S103N probably benign Het
Krtap17-1 T C 11: 99,993,618 T108A unknown Het
Man2a2 A G 7: 80,360,921 F774S probably benign Het
Map1b G A 13: 99,430,331 R1961W unknown Het
Mib2 A G 4: 155,656,051 probably benign Het
Mr1 A T 1: 155,136,788 F127I probably damaging Het
Mrgprb2 A G 7: 48,552,806 I57T probably benign Het
Ncan G T 8: 70,098,081 Y1154* probably null Het
Nfx1 T A 4: 40,977,285 S320T probably benign Het
Nlrp4f A G 13: 65,187,555 L740P probably damaging Het
Nprl2 T C 9: 107,545,078 probably benign Het
Olfr1350 A T 7: 6,570,173 I61F probably benign Het
Opn1sw A G 6: 29,379,755 probably null Het
Palld A G 8: 61,533,352 probably null Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Rnf145 T C 11: 44,542,722 probably null Het
Sbf2 A T 7: 110,378,096 C610* probably null Het
Sec24a C T 11: 51,756,137 A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 probably benign Het
Sox8 A C 17: 25,567,469 L420R probably damaging Het
Sry C G Y: 2,662,612 Q349H unknown Het
Sspo A G 6: 48,464,596 D1889G probably benign Het
Sspo A T 6: 48,491,484 H4382L possibly damaging Het
Tmem65 T C 15: 58,790,188 I141V probably damaging Het
Tpr A T 1: 150,425,649 T1329S probably benign Het
Trim17 C T 11: 58,968,562 R201W probably damaging Het
Trim3 A G 7: 105,617,975 L399P possibly damaging Het
Trim7 A G 11: 48,845,650 D277G possibly damaging Het
Vstm2b A G 7: 40,902,683 N153S possibly damaging Het
Wnk2 G T 13: 49,078,085 Q786K probably damaging Het
Wnk4 A G 11: 101,263,894 *286W probably null Het
Xpot A T 10: 121,615,093 L134Q probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zc3h7a G A 16: 11,164,602 Q20* probably null Het
Zfp599 C T 9: 22,249,834 C345Y probably damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGAACAGCTTTTCAGAAGTAGC -3'
(R):5'- GGTTGTATGACAAGTAAGCTCATG -3'

Sequencing Primer
(F):5'- GCTTCTGCTTAAGGGACAATTC -3'
(R):5'- TATGACAAGTAAGCTCATGAAAGTG -3'
Posted On2017-02-28