Incidental Mutation 'R5915:Sox8'
ID461291
Institutional Source Beutler Lab
Gene Symbol Sox8
Ensembl Gene ENSMUSG00000024176
Gene NameSRY (sex determining region Y)-box 8
Synonyms
MMRRC Submission 044112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5915 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25565892-25570686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25567469 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 420 (L420R)
Ref Sequence ENSEMBL: ENSMUSP00000025003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]
Predicted Effect probably damaging
Transcript: ENSMUST00000025003
AA Change: L420R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: L420R

DomainStartEndE-ValueType
Pfam:Sox_N 18 86 3.8e-27 PFAM
HMG 98 168 3.86e-28 SMART
low complexity region 208 228 N/A INTRINSIC
low complexity region 303 321 N/A INTRINSIC
low complexity region 375 397 N/A INTRINSIC
low complexity region 407 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163493
Predicted Effect probably benign
Transcript: ENSMUST00000173447
SMART Domains Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176

DomainStartEndE-ValueType
Pfam:Sox_N 3 87 3.3e-25 PFAM
HMG 98 168 3.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174560
SMART Domains Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176

DomainStartEndE-ValueType
HMG 1 66 1.19e-19 SMART
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,667,163 V940E probably damaging Het
Adgrg7 A T 16: 56,730,385 probably null Het
Alox12e T C 11: 70,318,224 I399V possibly damaging Het
Apoa5 C A 9: 46,269,309 Q42K probably damaging Het
Arfgap1 A G 2: 180,978,422 Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 probably null Het
Arl16 G A 11: 120,466,605 probably benign Het
Atp8b5 A G 4: 43,370,577 D951G probably damaging Het
Babam2 T A 5: 31,785,611 L80Q probably damaging Het
Celsr1 C T 15: 86,030,349 R1141H probably damaging Het
Celsr1 C T 15: 85,937,975 V1714I probably benign Het
Cep295 A G 9: 15,341,479 L351P probably damaging Het
Dlc1 T A 8: 36,938,675 probably benign Het
Dpy30 G T 17: 74,315,911 D25E probably benign Het
Drosha T C 15: 12,935,066 W998R probably damaging Het
Fibp A G 19: 5,463,616 D220G possibly damaging Het
Grm3 C T 5: 9,511,927 C641Y probably damaging Het
Gulo A T 14: 66,008,121 V8D probably benign Het
Ifrd1 A T 12: 40,213,096 C164S possibly damaging Het
Jam2 G A 16: 84,809,407 S103N probably benign Het
Krtap17-1 T C 11: 99,993,618 T108A unknown Het
Man2a2 A G 7: 80,360,921 F774S probably benign Het
Map1b G A 13: 99,430,331 R1961W unknown Het
Mib2 A G 4: 155,656,051 probably benign Het
Mr1 A T 1: 155,136,788 F127I probably damaging Het
Mrgprb2 A G 7: 48,552,806 I57T probably benign Het
Ncan G T 8: 70,098,081 Y1154* probably null Het
Nfx1 T A 4: 40,977,285 S320T probably benign Het
Nlrp4f A G 13: 65,187,555 L740P probably damaging Het
Nprl2 T C 9: 107,545,078 probably benign Het
Olfr1350 A T 7: 6,570,173 I61F probably benign Het
Opn1sw A G 6: 29,379,755 probably null Het
Palld A G 8: 61,533,352 probably null Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Rnf145 T C 11: 44,542,722 probably null Het
Sbf2 A T 7: 110,378,096 C610* probably null Het
Sec24a C T 11: 51,756,137 A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 probably benign Het
Sry C G Y: 2,662,612 Q349H unknown Het
Sspo A T 6: 48,491,484 H4382L possibly damaging Het
Sspo A G 6: 48,464,596 D1889G probably benign Het
Tmem65 T C 15: 58,790,188 I141V probably damaging Het
Tpr A T 1: 150,425,649 T1329S probably benign Het
Trim17 C T 11: 58,968,562 R201W probably damaging Het
Trim3 A G 7: 105,617,975 L399P possibly damaging Het
Trim7 A G 11: 48,845,650 D277G possibly damaging Het
Vstm2b A G 7: 40,902,683 N153S possibly damaging Het
Wnk2 G T 13: 49,078,085 Q786K probably damaging Het
Wnk4 A G 11: 101,263,894 *286W probably null Het
Xpot A T 10: 121,615,093 L134Q probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zc3h7a G A 16: 11,164,602 Q20* probably null Het
Zfp599 C T 9: 22,249,834 C345Y probably damaging Het
Other mutations in Sox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Sox8 APN 17 25567528 unclassified probably null
IGL01918:Sox8 APN 17 25570137 missense probably damaging 1.00
IGL02672:Sox8 APN 17 25568989 missense probably damaging 1.00
IGL03371:Sox8 APN 17 25567440 missense probably damaging 1.00
R1398:Sox8 UTSW 17 25567883 missense probably benign 0.01
R1673:Sox8 UTSW 17 25567482 missense possibly damaging 0.77
R1742:Sox8 UTSW 17 25567941 missense probably damaging 0.99
R4019:Sox8 UTSW 17 25570297 missense probably damaging 1.00
R4353:Sox8 UTSW 17 25567335 makesense probably null
R4466:Sox8 UTSW 17 25568905 missense probably benign 0.37
R4893:Sox8 UTSW 17 25568989 missense probably damaging 1.00
R4929:Sox8 UTSW 17 25570356 missense probably benign 0.21
R6114:Sox8 UTSW 17 25567520 missense probably damaging 1.00
R6915:Sox8 UTSW 17 25567914 missense probably damaging 1.00
R7030:Sox8 UTSW 17 25570108 critical splice donor site probably null
R7232:Sox8 UTSW 17 25567540 missense probably benign 0.01
R7549:Sox8 UTSW 17 25567961 missense not run
Predicted Primers PCR Primer
(F):5'- CGGAAGAACTCAAAGATCTGGC -3'
(R):5'- CTTCGGCCACAGATCAAGAC -3'

Sequencing Primer
(F):5'- CAAAGATCTGGCTAGACTTCCTGG -3'
(R):5'- GCAGCTGAGTCCTAGCCACTAC -3'
Posted On2017-02-28