Incidental Mutation 'R5916:Clrn1'
ID461314
Institutional Source Beutler Lab
Gene Symbol Clrn1
Ensembl Gene ENSMUSG00000043850
Gene Nameclarin 1
SynonymsUsh3a, A130002D11Rik, USH3, clarin-1
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5916 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58844028-58885340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58846362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 193 (T193A)
Ref Sequence ENSEMBL: ENSMUSP00000052254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051408] [ENSMUST00000055636] [ENSMUST00000072551]
Predicted Effect probably benign
Transcript: ENSMUST00000051408
AA Change: T175A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000051738
Gene: ENSMUSG00000043850
AA Change: T175A

DomainStartEndE-ValueType
Pfam:Claudin_2 18 208 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055636
AA Change: T193A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000052254
Gene: ENSMUSG00000043850
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072551
AA Change: T115A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072363
Gene: ENSMUSG00000043850
AA Change: T115A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1hw7a_ 65 87 5e-3 SMART
transmembrane domain 129 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161419
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss and loss of balance associated with defects in outer hair cells and supporting cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Clrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Clrn1 APN 3 58885025 missense probably damaging 0.99
IGL03184:Clrn1 APN 3 58846224 missense probably benign 0.00
IGL03187:Clrn1 APN 3 58846433 missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58846427 missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58846427 missense probably damaging 0.99
R1055:Clrn1 UTSW 3 58865110 missense probably benign 0.38
R2301:Clrn1 UTSW 3 58846352 missense probably damaging 1.00
R4753:Clrn1 UTSW 3 58884897 missense probably damaging 1.00
R5493:Clrn1 UTSW 3 58846416 missense probably damaging 1.00
R6393:Clrn1 UTSW 3 58846320 missense probably damaging 1.00
R6719:Clrn1 UTSW 3 58846440 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCAAAGGAAGTCCATATCC -3'
(R):5'- GAATCAAGCTCATGACTGCAG -3'

Sequencing Primer
(F):5'- GCCAAAGGAAGTCCATATCCTTATTG -3'
(R):5'- CAAGCTCATGACTGCAGTTTTAC -3'
Posted On2017-02-28