Incidental Mutation 'R5916:Zkscan5'
ID461320
Institutional Source Beutler Lab
Gene Symbol Zkscan5
Ensembl Gene ENSMUSG00000055991
Gene Namezinc finger with KRAB and SCAN domains 5
SynonymsZfp95, hKraba1
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R5916 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145204562-145221750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145205302 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 3 (M3K)
Ref Sequence ENSEMBL: ENSMUSP00000124838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031601] [ENSMUST00000031632] [ENSMUST00000085671] [ENSMUST00000161896] [ENSMUST00000162220] [ENSMUST00000198959]
Predicted Effect probably benign
Transcript: ENSMUST00000031601
AA Change: M3K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031601
Gene: ENSMUSG00000055991
AA Change: M3K

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 9.73e-4 SMART
ZnF_C2H2 324 346 1.45e-2 SMART
ZnF_C2H2 352 374 1.28e-3 SMART
ZnF_C2H2 467 489 1.82e-3 SMART
ZnF_C2H2 495 517 3.63e-3 SMART
ZnF_C2H2 523 545 7.78e-3 SMART
ZnF_C2H2 551 573 9.73e-4 SMART
ZnF_C2H2 579 601 1.08e-1 SMART
ZnF_C2H2 635 657 1.12e-3 SMART
ZnF_C2H2 691 713 5.14e-3 SMART
ZnF_C2H2 719 741 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031632
SMART Domains Protein: ENSMUSP00000031632
Gene: ENSMUSG00000029627

DomainStartEndE-ValueType
SCAN 40 152 6.65e-65 SMART
KRAB 135 196 2.79e-13 SMART
low complexity region 258 269 N/A INTRINSIC
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 4.01e-5 SMART
ZnF_C2H2 383 405 1.04e-3 SMART
ZnF_C2H2 411 432 2.82e0 SMART
ZnF_C2H2 438 460 4.54e-4 SMART
ZnF_C2H2 466 488 1.95e-3 SMART
ZnF_C2H2 494 516 1.69e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085671
AA Change: M3K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082814
Gene: ENSMUSG00000055991
AA Change: M3K

DomainStartEndE-ValueType
SCAN 46 155 2.18e-69 SMART
KRAB 216 276 5.35e-3 SMART
ZnF_C2H2 341 363 3.58e-2 SMART
ZnF_C2H2 369 391 9.73e-4 SMART
ZnF_C2H2 397 419 1.45e-2 SMART
ZnF_C2H2 425 447 1.28e-3 SMART
ZnF_C2H2 540 562 1.82e-3 SMART
ZnF_C2H2 568 590 3.63e-3 SMART
ZnF_C2H2 596 618 7.78e-3 SMART
ZnF_C2H2 624 646 9.73e-4 SMART
ZnF_C2H2 652 674 1.08e-1 SMART
ZnF_C2H2 708 730 1.12e-3 SMART
ZnF_C2H2 764 786 5.14e-3 SMART
ZnF_C2H2 792 814 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160162
Predicted Effect probably benign
Transcript: ENSMUST00000161881
SMART Domains Protein: ENSMUSP00000124544
Gene: ENSMUSG00000055991

DomainStartEndE-ValueType
KRAB 59 118 2.71e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161896
AA Change: M3K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124838
Gene: ENSMUSG00000055991
AA Change: M3K

DomainStartEndE-ValueType
SCAN 46 155 1.59e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162168
Predicted Effect probably benign
Transcript: ENSMUST00000162220
SMART Domains Protein: ENSMUSP00000124196
Gene: ENSMUSG00000029627

DomainStartEndE-ValueType
KRAB 1 62 2.79e-13 SMART
low complexity region 124 135 N/A INTRINSIC
ZnF_C2H2 193 215 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198959
SMART Domains Protein: ENSMUSP00000143630
Gene: ENSMUSG00000029627

DomainStartEndE-ValueType
SCAN 40 143 4.29e-59 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain and may be involved in transcriptional regulation. A similar protein in mouse is differentially expressed in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Zkscan5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Zkscan5 APN 5 145218650 missense probably damaging 0.99
R0401:Zkscan5 UTSW 5 145212575 missense probably damaging 0.99
R0458:Zkscan5 UTSW 5 145205471 missense probably damaging 0.97
R1456:Zkscan5 UTSW 5 145220988 missense probably benign 0.03
R1801:Zkscan5 UTSW 5 145220205 missense probably damaging 1.00
R2269:Zkscan5 UTSW 5 145205467 missense probably damaging 1.00
R2426:Zkscan5 UTSW 5 145220940 missense probably benign
R3085:Zkscan5 UTSW 5 145221079 missense probably damaging 1.00
R3153:Zkscan5 UTSW 5 145212627 missense probably benign
R3725:Zkscan5 UTSW 5 145220913 missense probably damaging 0.98
R4479:Zkscan5 UTSW 5 145211174 intron probably benign
R4647:Zkscan5 UTSW 5 145218830 missense possibly damaging 0.71
R5292:Zkscan5 UTSW 5 145218641 missense probably damaging 1.00
R5872:Zkscan5 UTSW 5 145220088 missense probably benign
R5873:Zkscan5 UTSW 5 145220394 missense possibly damaging 0.71
R6692:Zkscan5 UTSW 5 145221084 unclassified probably null
R7092:Zkscan5 UTSW 5 145220089 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAGAAGTGATGACTAACTTCTC -3'
(R):5'- CTGCCTCATGGTACTGGAAG -3'

Sequencing Primer
(F):5'- AAGTGAATGACTTTGTTGAGTGG -3'
(R):5'- CATGGTACTGGAAGTGCTTGAAGC -3'
Posted On2017-02-28