Incidental Mutation 'R5916:Il17re'
ID461323
Institutional Source Beutler Lab
Gene Symbol Il17re
Ensembl Gene ENSMUSG00000043088
Gene Nameinterleukin 17 receptor E
SynonymsIl25r
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5916 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113458484-113470758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113470123 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 612 (C612S)
Ref Sequence ENSEMBL: ENSMUSP00000145384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053569] [ENSMUST00000058300] [ENSMUST00000058548] [ENSMUST00000101065] [ENSMUST00000203281] [ENSMUST00000203661] [ENSMUST00000204774]
Predicted Effect probably benign
Transcript: ENSMUST00000053569
AA Change: C431S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054378
Gene: ENSMUSG00000043088
AA Change: C431S

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058300
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058548
AA Change: C632S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062103
Gene: ENSMUSG00000043088
AA Change: C632S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 6.2e-121 PFAM
transmembrane domain 415 437 N/A INTRINSIC
Pfam:SEFIR 448 585 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101065
AA Change: C431S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098626
Gene: ENSMUSG00000043088
AA Change: C431S

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203281
SMART Domains Protein: ENSMUSP00000145363
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203661
AA Change: C586S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145345
Gene: ENSMUSG00000043088
AA Change: C586S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
Pfam:SEFIR 403 539 1.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203897
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect probably benign
Transcript: ENSMUST00000204632
Predicted Effect probably damaging
Transcript: ENSMUST00000204774
AA Change: C612S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145384
Gene: ENSMUSG00000043088
AA Change: C612S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:SEFIR 428 565 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205211
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as the receptor for interleukin-17C. The encoded protein signals to downstream components of the mitogen activated protein kinase (MAPK) pathway. Activity of this protein is important in the immune response to bacterial pathogens. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice exhibit increased susceptibility to DSS-induced colitis, imiquimod-induced psoriasis, and C. rodentium bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Il17re
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Il17re APN 6 113469599 missense probably damaging 0.99
IGL01568:Il17re APN 6 113470052 missense probably damaging 1.00
IGL01656:Il17re APN 6 113462973 splice site probably benign
IGL01994:Il17re APN 6 113468450 missense probably benign 0.13
IGL02261:Il17re APN 6 113468511 unclassified probably benign
IGL02699:Il17re APN 6 113468919 missense probably damaging 1.00
PIT4382001:Il17re UTSW 6 113469077 missense probably benign 0.00
R0195:Il17re UTSW 6 113466137 missense probably damaging 1.00
R1901:Il17re UTSW 6 113469704 missense probably damaging 0.98
R2232:Il17re UTSW 6 113464800 missense probably damaging 1.00
R2357:Il17re UTSW 6 113468470 missense possibly damaging 0.55
R2393:Il17re UTSW 6 113462353 missense possibly damaging 0.91
R2916:Il17re UTSW 6 113466028 critical splice donor site probably null
R4820:Il17re UTSW 6 113465855 missense probably benign 0.08
R4951:Il17re UTSW 6 113468907 missense probably damaging 1.00
R4974:Il17re UTSW 6 113469569 missense probably benign 0.14
R5070:Il17re UTSW 6 113459010 missense probably damaging 0.97
R5166:Il17re UTSW 6 113462962 missense probably benign 0.00
R5404:Il17re UTSW 6 113469102 missense probably benign 0.00
R5810:Il17re UTSW 6 113469596 missense probably damaging 1.00
R6048:Il17re UTSW 6 113470108 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGCGCCAAAGGTGACATC -3'
(R):5'- GAAAGCCCAAGTTCCTCTCAG -3'

Sequencing Primer
(F):5'- AAAGGTGACATCCCCCGG -3'
(R):5'- CCTCTCAGGAACTCTAAGAGGG -3'
Posted On2017-02-28