Incidental Mutation 'R5916:U2af2'
ID461325
Institutional Source Beutler Lab
Gene Symbol U2af2
Ensembl Gene ENSMUSG00000030435
Gene NameU2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Synonyms
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.980) question?
Stock #R5916 (G1)
Quality Score223
Status Not validated
Chromosome7
Chromosomal Location5062143-5079938 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 5079180 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005041] [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000146317] [ENSMUST00000153169] [ENSMUST00000165399] [ENSMUST00000208634] [ENSMUST00000209099]
Predicted Effect probably null
Transcript: ENSMUST00000005041
SMART Domains Protein: ENSMUSP00000005041
Gene: ENSMUSG00000030435

DomainStartEndE-ValueType
low complexity region 23 62 N/A INTRINSIC
PDB:1JMT|B 85 112 9e-13 PDB
RRM 150 227 1.26e-11 SMART
low complexity region 242 257 N/A INTRINSIC
RRM 260 333 8.64e-19 SMART
RRM 377 462 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045277
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098845
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146317
SMART Domains Protein: ENSMUSP00000116571
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 90 7.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152083
Predicted Effect probably benign
Transcript: ENSMUST00000153169
SMART Domains Protein: ENSMUSP00000122594
Gene: ENSMUSG00000035203

DomainStartEndE-ValueType
Pfam:ENTH 17 54 3.8e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165399
SMART Domains Protein: ENSMUSP00000131458
Gene: ENSMUSG00000030435

DomainStartEndE-ValueType
RRM 8 63 3.31e0 SMART
low complexity region 78 93 N/A INTRINSIC
RRM 96 169 8.64e-19 SMART
RRM 209 294 3.04e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207926
Predicted Effect probably benign
Transcript: ENSMUST00000208634
Predicted Effect probably null
Transcript: ENSMUST00000209099
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] U2 auxiliary factor (U2AF), comprised of a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the U2AF large subunit which contains a sequence-specific RNA-binding region with 3 RNA recognition motifs and an Arg/Ser-rich domain necessary for splicing. The large subunit binds to the polypyrimidine tract of introns early during spliceosome assembly. Multiple transcript variants have been detected for this gene, but the full-length natures of only two have been determined to date. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in U2af2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03368:U2af2 APN 7 5067264 splice site probably benign
IGL02980:U2af2 UTSW 7 5068043 missense probably benign 0.37
R0919:U2af2 UTSW 7 5069434 splice site probably benign
R1768:U2af2 UTSW 7 5067545 missense probably benign 0.00
R2228:U2af2 UTSW 7 5075673 missense probably damaging 1.00
R2697:U2af2 UTSW 7 5067546 missense probably benign 0.00
R3974:U2af2 UTSW 7 5069439 splice site probably null
R5777:U2af2 UTSW 7 5066451 missense probably benign 0.37
R6290:U2af2 UTSW 7 5075684 missense probably benign
R6860:U2af2 UTSW 7 5079274 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTAAGTGACTCAGGCCTGCC -3'
(R):5'- TCTGCCCATCTTCTTCAAGAGG -3'

Sequencing Primer
(F):5'- GTGATGTCTCGCTTCTGTGCC -3'
(R):5'- GGAAAGTCCCCAGCCAGC -3'
Posted On2017-02-28