Incidental Mutation 'R5916:March1'
ID461333
Institutional Source Beutler Lab
Gene Symbol March1
Ensembl Gene ENSMUSG00000036469
Gene Namemembrane-associated ring finger (C3HC4) 1
Synonyms
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5916 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location65617900-66471637 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66387111 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 182 (R182L)
Ref Sequence ENSEMBL: ENSMUSP00000105885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039540] [ENSMUST00000072482] [ENSMUST00000098708] [ENSMUST00000110253] [ENSMUST00000110255] [ENSMUST00000110256] [ENSMUST00000110258] [ENSMUST00000110259] [ENSMUST00000178982]
Predicted Effect probably benign
Transcript: ENSMUST00000039540
SMART Domains Protein: ENSMUSP00000044070
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072482
SMART Domains Protein: ENSMUSP00000072302
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098708
SMART Domains Protein: ENSMUSP00000096305
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110253
SMART Domains Protein: ENSMUSP00000105882
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
RINGv 69 117 2.63e-22 SMART
transmembrane domain 145 167 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110255
SMART Domains Protein: ENSMUSP00000105884
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110256
AA Change: R182L

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105885
Gene: ENSMUSG00000036469
AA Change: R182L

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 111 125 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
RINGv 330 378 2.14e-22 SMART
transmembrane domain 406 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110258
SMART Domains Protein: ENSMUSP00000105887
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110259
SMART Domains Protein: ENSMUSP00000105888
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 25 54 N/A INTRINSIC
RINGv 75 123 2.63e-22 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152320
Predicted Effect probably benign
Transcript: ENSMUST00000178982
SMART Domains Protein: ENSMUSP00000136545
Gene: ENSMUSG00000036469

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
RINGv 79 127 2.63e-22 SMART
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal dendritic cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in March1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:March1 APN 8 66418877 missense possibly damaging 0.88
IGL02468:March1 APN 8 66418911 missense probably damaging 1.00
R0391:March1 UTSW 8 66418973 missense probably damaging 1.00
R1500:March1 UTSW 8 66468390 missense probably damaging 1.00
R1794:March1 UTSW 8 66386942 missense possibly damaging 0.63
R2015:March1 UTSW 8 66121821 missense probably damaging 0.99
R2184:March1 UTSW 8 66387423 missense probably benign 0.07
R2273:March1 UTSW 8 66387499 missense probably benign 0.15
R2274:March1 UTSW 8 66387499 missense probably benign 0.15
R2275:March1 UTSW 8 66387499 missense probably benign 0.15
R2314:March1 UTSW 8 66121790 start codon destroyed probably null 0.77
R3114:March1 UTSW 8 66387381 missense probably benign
R4458:March1 UTSW 8 66456171 missense probably damaging 1.00
R4656:March1 UTSW 8 66386419 missense probably benign 0.05
R4773:March1 UTSW 8 66387224 missense probably benign 0.03
R4838:March1 UTSW 8 66468363 missense probably damaging 1.00
R5073:March1 UTSW 8 66386368 missense probably benign 0.03
R5507:March1 UTSW 8 66418890 missense probably damaging 1.00
R5575:March1 UTSW 8 66468310 missense probably damaging 1.00
R6931:March1 UTSW 8 66468492 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCATGCTAGAAAAGAGTCTGG -3'
(R):5'- ACTGCATTCTTGGTACCTTATGAC -3'

Sequencing Primer
(F):5'- GGGTTTCTCAGAGATATGAACATGC -3'
(R):5'- GGTACCTTATGACTTTTCCTCTACAG -3'
Posted On2017-02-28