Incidental Mutation 'R5916:Ntrk2'
ID461353
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R5916 (G1)
Quality Score114
Status Not validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 58808729 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000153337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000109838] [ENSMUST00000224259] [ENSMUST00000224402] [ENSMUST00000225488] [ENSMUST00000225583] [ENSMUST00000225950]
Predicted Effect probably null
Transcript: ENSMUST00000079828
AA Change: M1V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: M1V

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109838
AA Change: M1V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105464
Gene: ENSMUSG00000055254
AA Change: M1V

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.1e-8 PFAM
Pfam:Ig_2 300 377 5.4e-4 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224259
AA Change: M1V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably null
Transcript: ENSMUST00000224402
AA Change: M1V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225162
Predicted Effect probably null
Transcript: ENSMUST00000225488
AA Change: M1V

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably null
Transcript: ENSMUST00000225583
AA Change: M1V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000225950
AA Change: M1V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0615:Ntrk2 UTSW 13 59128186 nonsense probably null
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R2926:Ntrk2 UTSW 13 59060284 missense probably damaging 1.00
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5356:Ntrk2 UTSW 13 59060242 missense probably damaging 1.00
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6488:Ntrk2 UTSW 13 58861356 missense possibly damaging 0.93
R6611:Ntrk2 UTSW 13 59054414 missense probably damaging 1.00
R6827:Ntrk2 UTSW 13 59126568 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCCCAGCCACTGTGAAC -3'
(R):5'- GGTCAACGCTGTTAGGTTCC -3'

Sequencing Primer
(F):5'- AGCCACTGTGAACCATTTGG -3'
(R):5'- TTCCAACCTCGGGAATGC -3'
Posted On2017-02-28