Incidental Mutation 'R5916:Papd4'
ID461355
Institutional Source Beutler Lab
Gene Symbol Papd4
Ensembl Gene ENSMUSG00000042167
Gene NamePAP associated domain containing 4
Synonyms8030446C20Rik
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R5916 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93146282-93192385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93175547 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000153703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048702] [ENSMUST00000224545] [ENSMUST00000225868]
Predicted Effect probably damaging
Transcript: ENSMUST00000048702
AA Change: D215G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048124
Gene: ENSMUSG00000042167
AA Change: D215G

DomainStartEndE-ValueType
low complexity region 134 147 N/A INTRINSIC
Pfam:PAP_assoc 386 440 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224545
Predicted Effect probably damaging
Transcript: ENSMUST00000225868
AA Change: D215G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele reuslts in disruption in polyadenylation in oocytes and somatic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Papd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Papd4 APN 13 93186397 missense probably benign 0.01
IGL02312:Papd4 APN 13 93175533 missense probably benign
IGL02896:Papd4 APN 13 93168437 missense probably damaging 1.00
IGL02802:Papd4 UTSW 13 93148941 missense probably damaging 1.00
R0538:Papd4 UTSW 13 93175615 splice site probably benign
R0568:Papd4 UTSW 13 93154992 missense probably benign 0.20
R0733:Papd4 UTSW 13 93155039 missense probably benign 0.05
R1136:Papd4 UTSW 13 93175697 critical splice donor site probably null
R1537:Papd4 UTSW 13 93175568 missense probably damaging 1.00
R1603:Papd4 UTSW 13 93175565 missense probably benign
R2508:Papd4 UTSW 13 93184218 missense probably damaging 1.00
R4920:Papd4 UTSW 13 93186325 nonsense probably null
R5881:Papd4 UTSW 13 93175738 nonsense probably null
R6333:Papd4 UTSW 13 93186313 nonsense probably null
R6783:Papd4 UTSW 13 93155018 missense probably benign 0.00
R6783:Papd4 UTSW 13 93155019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTAGTGGTGCCTGACATG -3'
(R):5'- TGAAACTTGTCAGCAGCAAGC -3'

Sequencing Primer
(F):5'- CCTGACATGTGTGGGGCAG -3'
(R):5'- CTGCAGAGAGAGATCCAGCTGC -3'
Posted On2017-02-28