Incidental Mutation 'R5916:Tbc1d22a'
ID461361
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene NameTBC1 domain family, member 22a
SynonymsD15Ertd781e
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5916 (G1)
Quality Score97
Status Not validated
Chromosome15
Chromosomal Location86214459-86498503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86214608 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 12 (K12E)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063414
AA Change: K12E

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: K12E

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157446
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86301555 missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86391203 missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86299669 missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86239171 missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86299684 missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86292134 missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86496826 missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86351651 splice site probably null
R1703:Tbc1d22a UTSW 15 86239215 missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86239149 missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86391065 splice site probably null
R4380:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86235685 missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86311836 missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86496916 missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86311748 missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86391086 missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86351728 missense probably damaging 0.98
R6360:Tbc1d22a UTSW 15 86214629 missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86301567 missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86239155 missense probably benign 0.07
R7294:Tbc1d22a UTSW 15 86311835 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAATCGCCGAGTCACAACTTC -3'
(R):5'- TCCTTGCTCATTGGTACGGC -3'

Sequencing Primer
(F):5'- AGTCACAACTTCCGGACGGAG -3'
(R):5'- TGGTACGGCCACTGTCAC -3'
Posted On2017-02-28