Incidental Mutation 'R5917:Cryz'
ID461383
Institutional Source Beutler Lab
Gene Symbol Cryz
Ensembl Gene ENSMUSG00000028199
Gene Namecrystallin, zeta
SynonymsSez9, quinone reductase, SEZ9
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location154596711-154623182 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154621766 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 144 (S144T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029850] [ENSMUST00000135723] [ENSMUST00000155232] [ENSMUST00000184537] [ENSMUST00000192462] [ENSMUST00000194876]
Predicted Effect probably benign
Transcript: ENSMUST00000029850
AA Change: S276T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029850
Gene: ENSMUSG00000028199
AA Change: S276T

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 3.3e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.3e-30 PFAM
Pfam:ADH_zinc_N_2 192 329 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135723
SMART Domains Protein: ENSMUSP00000143311
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
PDB:1YB5|B 1 38 5e-17 PDB
SCOP:d1qora1 9 38 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155232
SMART Domains Protein: ENSMUSP00000118449
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 135 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184537
SMART Domains Protein: ENSMUSP00000139387
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 180 4.7e-17 PFAM
Pfam:ADH_zinc_N 160 218 5.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192462
AA Change: S276T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142105
Gene: ENSMUSG00000028199
AA Change: S276T

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 2.8e-16 PFAM
Pfam:ADH_zinc_N 160 290 1.8e-29 PFAM
Pfam:ADH_zinc_N_2 192 329 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194876
AA Change: S276T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142101
Gene: ENSMUSG00000028199
AA Change: S276T

DomainStartEndE-ValueType
Pfam:ADH_N 35 139 2.2e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195103
AA Change: S144T

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195292
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. The former class is also called phylogenetically-restricted crystallins. This gene encodes a taxon-specific crystallin protein which has NADPH-dependent quinone reductase activity distinct from other known quinone reductases. It lacks alcohol dehydrogenase activity although by similarity it is considered a member of the zinc-containing alcohol dehydrogenase family. Unlike other mammalian species, in humans, lens expression is low. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One pseudogene is known to exist. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Cryz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cryz APN 3 154604942 missense possibly damaging 0.95
IGL00838:Cryz APN 3 154618475 missense probably damaging 1.00
IGL00969:Cryz APN 3 154618526 nonsense probably null
IGL01571:Cryz APN 3 154621743 missense probably damaging 1.00
IGL03082:Cryz APN 3 154604926 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R1116:Cryz UTSW 3 154621603 splice site probably benign
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1586:Cryz UTSW 3 154611510 missense probably benign 0.00
R2018:Cryz UTSW 3 154621683 missense probably damaging 1.00
R2223:Cryz UTSW 3 154618554 missense possibly damaging 0.86
R2334:Cryz UTSW 3 154622191 missense probably benign 0.04
R4488:Cryz UTSW 3 154618457 splice site probably benign
R5547:Cryz UTSW 3 154611557 nonsense probably null
R5595:Cryz UTSW 3 154606518 missense probably damaging 1.00
R7197:Cryz UTSW 3 154621568 missense probably damaging 0.99
R7473:Cryz UTSW 3 154606520 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTTCAGCACCGTGAATTTC -3'
(R):5'- GATTGACAGTTTTCCCAGATCCAC -3'

Sequencing Primer
(F):5'- CGTGAATTTCACCAGGGCTCAAG -3'
(R):5'- CATTTGCATATGCCTGGGAC -3'
Posted On2017-02-28