Incidental Mutation 'R5917:Limk1'
ID461387
Institutional Source Beutler Lab
Gene Symbol Limk1
Ensembl Gene ENSMUSG00000029674
Gene NameLIM-domain containing, protein kinase
Synonyms
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134656039-134688598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134657935 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 533 (F533L)
Ref Sequence ENSEMBL: ENSMUSP00000015137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015137] [ENSMUST00000111233] [ENSMUST00000138590]
Predicted Effect probably damaging
Transcript: ENSMUST00000015137
AA Change: F533L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015137
Gene: ENSMUSG00000029674
AA Change: F533L

DomainStartEndE-ValueType
LIM 24 75 5.3e-19 SMART
LIM 83 137 1.73e-9 SMART
PDZ 176 258 1.51e-9 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:Pkinase 339 604 1.7e-49 PFAM
Pfam:Pkinase_Tyr 339 604 1.5e-55 PFAM
Pfam:Kdo 345 509 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111233
AA Change: F525L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106864
Gene: ENSMUSG00000029674
AA Change: F525L

DomainStartEndE-ValueType
LIM 23 67 2.19e-1 SMART
LIM 75 129 1.73e-9 SMART
PDZ 168 250 1.51e-9 SMART
low complexity region 258 269 N/A INTRINSIC
Pfam:Pkinase_Tyr 331 596 1.5e-56 PFAM
Pfam:Pkinase 331 597 4.7e-50 PFAM
Pfam:Kdo 339 501 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134093
SMART Domains Protein: ENSMUSP00000121718
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
LIM 16 60 2.19e-1 SMART
LIM 68 122 1.73e-9 SMART
PDZ 161 243 1.51e-9 SMART
low complexity region 251 262 N/A INTRINSIC
Pfam:Pkinase 324 425 3.9e-16 PFAM
Pfam:Pkinase_Tyr 324 434 5.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138590
SMART Domains Protein: ENSMUSP00000118268
Gene: ENSMUSG00000029674

DomainStartEndE-ValueType
Pfam:Pkinase 3 59 3.6e-9 PFAM
Pfam:Pkinase_Tyr 3 80 2.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the LIM kinase family of proteins. This protein is a serine/threonine kinase that regulates actin polymerization via phosphorylation and inactivation of the actin binding factor cofilin. This protein also stimulates axon growth and may play a role in brain development. Homozygous knockout mice for this gene exhibit reduced bone mass, abnormal neuronal morphology and altered synaptic function. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal actin cytoskeleton in neurons of the central nervous system and structural abnormalities of the dendritic spines. Long term potentiation is altered and behavioral anomalies are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Limk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Limk1 APN 5 134657900 unclassified probably benign
IGL02029:Limk1 APN 5 134657954 nonsense probably null
IGL02211:Limk1 APN 5 134657637 missense probably damaging 1.00
IGL03000:Limk1 APN 5 134670501 missense probably damaging 0.99
extremist UTSW 5 134670441 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0046:Limk1 UTSW 5 134672761 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0058:Limk1 UTSW 5 134659871 missense probably damaging 1.00
R0071:Limk1 UTSW 5 134661391 missense probably benign 0.01
R0180:Limk1 UTSW 5 134669261 missense probably damaging 0.97
R1456:Limk1 UTSW 5 134657510 missense probably benign 0.09
R2225:Limk1 UTSW 5 134661556 splice site probably null
R2379:Limk1 UTSW 5 134679481 unclassified probably benign
R2899:Limk1 UTSW 5 134688300 intron probably null
R3423:Limk1 UTSW 5 134672669 critical splice donor site probably null
R4235:Limk1 UTSW 5 134670478 missense probably benign 0.00
R4516:Limk1 UTSW 5 134676786 intron probably benign
R4566:Limk1 UTSW 5 134686683 missense probably benign 0.12
R4752:Limk1 UTSW 5 134670441 missense probably damaging 1.00
R5682:Limk1 UTSW 5 134665205 critical splice donor site probably null
R6163:Limk1 UTSW 5 134657955 missense probably damaging 1.00
R6479:Limk1 UTSW 5 134661519 utr 3 prime probably benign
R6952:Limk1 UTSW 5 134670478 missense possibly damaging 0.76
R7009:Limk1 UTSW 5 134672699 missense probably benign
R7147:Limk1 UTSW 5 134657341 missense probably benign 0.14
R7453:Limk1 UTSW 5 134669237 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATACCCCACTGATGCTGTGC -3'
(R):5'- AGATAGCACATGGGTCCCAC -3'

Sequencing Primer
(F):5'- ACTGATGCTGTGCTCTGC -3'
(R):5'- GAACCAGGAGTGTCTCATTTTATGC -3'
Posted On2017-02-28