Incidental Mutation 'R5917:Chst15'
ID461397
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Namecarbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
SynonymsMAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5917 (G1)
Quality Score145
Status Not validated
Chromosome7
Chromosomal Location132235780-132317228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132270517 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000079105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000077472
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: F12L

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080215
AA Change: F12L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: F12L

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132508
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCAGGCTACATCGCTTC -3'
(R):5'- TGAACCAAAGACTGTGCCTC -3'

Sequencing Primer
(F):5'- AAAAACCCACCCCAGTTTTCATTG -3'
(R):5'- AAAGACTGTGCCTCATTCTCTAGTG -3'
Posted On2017-02-28