Incidental Mutation 'R5917:Tle3'
ID461403
Institutional Source Beutler Lab
Gene Symbol Tle3
Ensembl Gene ENSMUSG00000032280
Gene Nametransducin-like enhancer of split 3
Synonyms2610103N05Rik, ESG, Grg3a, Grg3b
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5917 (G1)
Quality Score190
Status Not validated
Chromosome9
Chromosomal Location61372366-61418497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61408908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 296 (D296G)
Ref Sequence ENSEMBL: ENSMUSP00000124557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034820] [ENSMUST00000159050] [ENSMUST00000159386] [ENSMUST00000159630] [ENSMUST00000160724] [ENSMUST00000160882] [ENSMUST00000161207] [ENSMUST00000161689] [ENSMUST00000161993] [ENSMUST00000162127] [ENSMUST00000162583] [ENSMUST00000162973] [ENSMUST00000178113]
Predicted Effect probably benign
Transcript: ENSMUST00000034820
AA Change: D303G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034820
Gene: ENSMUSG00000032280
AA Change: D303G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 4.3e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 468 505 2.96e-2 SMART
WD40 511 552 4.48e-2 SMART
WD40 557 596 2.84e-4 SMART
WD40 599 638 7.55e-9 SMART
WD40 641 679 3.07e1 SMART
WD40 681 720 4.18e-2 SMART
WD40 721 761 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159050
AA Change: D303G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125032
Gene: ENSMUSG00000032280
AA Change: D303G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 471 508 2.96e-2 SMART
WD40 514 555 4.48e-2 SMART
WD40 560 599 2.84e-4 SMART
WD40 602 641 7.55e-9 SMART
WD40 644 682 3.07e1 SMART
WD40 684 723 4.18e-2 SMART
WD40 724 764 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159140
Predicted Effect probably benign
Transcript: ENSMUST00000159386
AA Change: D303G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125049
Gene: ENSMUSG00000032280
AA Change: D303G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 464 501 2.96e-2 SMART
WD40 507 548 4.48e-2 SMART
WD40 553 592 2.84e-4 SMART
WD40 595 634 7.55e-9 SMART
WD40 637 675 3.07e1 SMART
WD40 677 716 4.18e-2 SMART
WD40 717 757 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159630
AA Change: D246G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123723
Gene: ENSMUSG00000032280
AA Change: D246G

DomainStartEndE-ValueType
Pfam:TLE_N 1 79 1.7e-43 PFAM
low complexity region 104 122 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
low complexity region 226 245 N/A INTRINSIC
WD40 416 453 2.96e-2 SMART
WD40 459 500 4.48e-2 SMART
WD40 505 544 2.84e-4 SMART
WD40 547 586 7.55e-9 SMART
WD40 589 627 3.07e1 SMART
WD40 629 668 4.18e-2 SMART
WD40 669 709 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160724
SMART Domains Protein: ENSMUSP00000124055
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 145 1.9e-77 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160882
AA Change: D313G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124131
Gene: ENSMUSG00000032280
AA Change: D313G

DomainStartEndE-ValueType
Pfam:TLE_N 1 146 4.8e-76 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
low complexity region 293 312 N/A INTRINSIC
WD40 486 523 2.96e-2 SMART
WD40 529 570 4.48e-2 SMART
WD40 575 614 2.84e-4 SMART
WD40 617 656 7.55e-9 SMART
WD40 659 697 3.07e1 SMART
WD40 699 738 4.18e-2 SMART
WD40 739 779 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161207
AA Change: D296G

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124557
Gene: ENSMUSG00000032280
AA Change: D296G

DomainStartEndE-ValueType
Pfam:TLE_N 1 129 1e-73 PFAM
low complexity region 154 172 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
WD40 466 503 2.96e-2 SMART
WD40 509 550 4.48e-2 SMART
WD40 555 594 2.84e-4 SMART
WD40 597 636 7.55e-9 SMART
WD40 639 677 3.07e1 SMART
WD40 679 718 4.18e-2 SMART
WD40 719 759 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161689
AA Change: D247G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125011
Gene: ENSMUSG00000032280
AA Change: D247G

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 4.8e-44 PFAM
low complexity region 105 123 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 227 246 N/A INTRINSIC
WD40 420 457 2.96e-2 SMART
WD40 463 504 4.48e-2 SMART
WD40 509 548 2.84e-4 SMART
WD40 551 590 7.55e-9 SMART
WD40 593 631 3.07e1 SMART
WD40 633 672 4.18e-2 SMART
WD40 673 713 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161993
AA Change: D302G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124432
Gene: ENSMUSG00000032280
AA Change: D302G

DomainStartEndE-ValueType
Pfam:TLE_N 1 135 2e-77 PFAM
low complexity region 160 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162127
AA Change: D250G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124150
Gene: ENSMUSG00000032280
AA Change: D250G

DomainStartEndE-ValueType
Pfam:TLE_N 1 83 1.2e-37 PFAM
low complexity region 108 126 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
WD40 406 443 2.96e-2 SMART
WD40 449 490 4.48e-2 SMART
WD40 495 534 2.84e-4 SMART
WD40 537 576 7.55e-9 SMART
WD40 579 617 3.07e1 SMART
WD40 619 658 4.18e-2 SMART
WD40 659 699 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162281
Predicted Effect probably benign
Transcript: ENSMUST00000162583
AA Change: D303G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124977
Gene: ENSMUSG00000032280
AA Change: D303G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 473 510 2.96e-2 SMART
WD40 516 557 4.48e-2 SMART
WD40 562 601 2.84e-4 SMART
WD40 604 643 7.55e-9 SMART
WD40 646 684 3.07e1 SMART
WD40 686 725 4.18e-2 SMART
WD40 726 766 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162962
Predicted Effect probably benign
Transcript: ENSMUST00000162973
AA Change: D303G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124173
Gene: ENSMUSG00000032280
AA Change: D303G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 476 513 2.96e-2 SMART
WD40 519 560 4.48e-2 SMART
WD40 565 604 2.84e-4 SMART
WD40 607 646 7.55e-9 SMART
WD40 649 687 3.07e1 SMART
WD40 689 728 4.18e-2 SMART
WD40 729 769 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178113
AA Change: D314G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136010
Gene: ENSMUSG00000032280
AA Change: D314G

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 6e-73 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 294 313 N/A INTRINSIC
WD40 487 524 2.96e-2 SMART
WD40 530 571 4.48e-2 SMART
WD40 576 615 2.84e-4 SMART
WD40 618 657 7.55e-9 SMART
WD40 660 698 3.07e1 SMART
WD40 700 739 4.18e-2 SMART
WD40 740 780 1.79e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homzoygous for a gene trap allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Tle3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Tle3 APN 9 61408757 splice site probably benign
IGL00671:Tle3 APN 9 61412370 missense probably damaging 1.00
IGL01583:Tle3 APN 9 61410025 missense probably benign 0.00
IGL01684:Tle3 APN 9 61403446 intron probably benign
IGL02109:Tle3 APN 9 61413050 missense probably damaging 1.00
IGL02386:Tle3 APN 9 61394659 missense possibly damaging 0.88
IGL02517:Tle3 APN 9 61414781 missense probably damaging 1.00
IGL02930:Tle3 APN 9 61394699 missense possibly damaging 0.52
IGL03103:Tle3 APN 9 61393242 missense possibly damaging 0.46
R0391:Tle3 UTSW 9 61416661 missense probably damaging 1.00
R0395:Tle3 UTSW 9 61410071 missense probably damaging 0.99
R0621:Tle3 UTSW 9 61410105 nonsense probably null
R1836:Tle3 UTSW 9 61414023 missense probably damaging 1.00
R1921:Tle3 UTSW 9 61411340 critical splice donor site probably null
R1978:Tle3 UTSW 9 61394633 missense probably damaging 1.00
R3434:Tle3 UTSW 9 61414094 unclassified probably null
R4242:Tle3 UTSW 9 61407423 missense probably benign
R4587:Tle3 UTSW 9 61374013 missense probably damaging 0.99
R4811:Tle3 UTSW 9 61373997 unclassified probably benign
R4877:Tle3 UTSW 9 61373499 intron probably benign
R4913:Tle3 UTSW 9 61373993 missense probably damaging 1.00
R5387:Tle3 UTSW 9 61407489 intron probably null
R5745:Tle3 UTSW 9 61414851 missense probably damaging 1.00
R5752:Tle3 UTSW 9 61407471 missense probably damaging 1.00
R6000:Tle3 UTSW 9 61374014 missense probably damaging 1.00
R6339:Tle3 UTSW 9 61401924 synonymous probably null
R7210:Tle3 UTSW 9 61412305 missense probably damaging 1.00
R7460:Tle3 UTSW 9 61413084 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCTTCCTGTTGCTAGGGC -3'
(R):5'- GCTCCAAAACATTCACTAGTGTG -3'

Sequencing Primer
(F):5'- GGATACCTGCTTTCAGCTTAAAAG -3'
(R):5'- TGTGGGTTAATGATTAAAGCACAGCC -3'
Posted On2017-02-28