Incidental Mutation 'R5917:Anks1b'
ID461414
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 90576941 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099364] [ENSMUST00000099368] [ENSMUST00000182045] [ENSMUST00000182053] [ENSMUST00000182083] [ENSMUST00000182113] [ENSMUST00000182284] [ENSMUST00000182356] [ENSMUST00000182427] [ENSMUST00000182430] [ENSMUST00000182550] [ENSMUST00000182595] [ENSMUST00000182600] [ENSMUST00000182786] [ENSMUST00000182907] [ENSMUST00000182960] [ENSMUST00000183136] [ENSMUST00000183156]
Predicted Effect probably benign
Transcript: ENSMUST00000099364
SMART Domains Protein: ENSMUSP00000096965
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
PTB 131 269 1.5e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099368
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182003
Predicted Effect probably benign
Transcript: ENSMUST00000182045
SMART Domains Protein: ENSMUSP00000138679
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
Pfam:SAM_1 34 69 1.6e-9 PFAM
Pfam:SAM_2 34 75 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182053
SMART Domains Protein: ENSMUSP00000138644
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
PTB 192 330 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182083
Predicted Effect probably benign
Transcript: ENSMUST00000182113
SMART Domains Protein: ENSMUSP00000138655
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182284
SMART Domains Protein: ENSMUSP00000138794
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 248 386 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182356
SMART Domains Protein: ENSMUSP00000138234
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
low complexity region 138 153 N/A INTRINSIC
PTB 226 364 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182427
SMART Domains Protein: ENSMUSP00000138480
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 2 71 1.19e-19 SMART
SAM 76 144 5.66e-17 SMART
low complexity region 164 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182430
SMART Domains Protein: ENSMUSP00000138660
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 223 361 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182550
SMART Domains Protein: ENSMUSP00000138643
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 308 446 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182595
SMART Domains Protein: ENSMUSP00000138314
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 283 421 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182600
SMART Domains Protein: ENSMUSP00000138650
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 1 45 4.05e1 SMART
SAM 50 118 5.66e-17 SMART
PTB 216 354 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182786
SMART Domains Protein: ENSMUSP00000138720
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
Pfam:SAM_2 1 42 8.4e-8 PFAM
Pfam:SAM_1 2 43 5.4e-7 PFAM
Pfam:SAM_1 51 97 4.4e-10 PFAM
Pfam:SAM_2 52 95 6.1e-7 PFAM
PTB 155 293 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182960
SMART Domains Protein: ENSMUSP00000138222
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
PTB 247 385 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183136
SMART Domains Protein: ENSMUSP00000138738
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
SAM 33 102 1.19e-19 SMART
SAM 107 175 5.66e-17 SMART
low complexity region 195 210 N/A INTRINSIC
PTB 307 445 2.94e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183156
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
R7325:Anks1b UTSW 10 90941432 missense probably damaging 1.00
R7392:Anks1b UTSW 10 90680786 missense possibly damaging 0.47
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCAGTCACATAGAACGCAG -3'
(R):5'- CCAATGCTTTCCAGCCATTG -3'

Sequencing Primer
(F):5'- AACGCAGAGCAGCCTAGGC -3'
(R):5'- AGCCATTGTCCCACTGTTTGG -3'
Posted On2017-02-28