Incidental Mutation 'R5917:Ascc2'
ID461416
Institutional Source Beutler Lab
Gene Symbol Ascc2
Ensembl Gene ENSMUSG00000020412
Gene Nameactivating signal cointegrator 1 complex subunit 2
Synonyms1700011I11Rik, ASC1p100, 2610034L15Rik
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5917 (G1)
Quality Score162
Status Not validated
Chromosome11
Chromosomal Location4637747-4685699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4681506 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 649 (L649P)
Ref Sequence ENSEMBL: ENSMUSP00000105556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070257] [ENSMUST00000109930]
Predicted Effect probably benign
Transcript: ENSMUST00000070257
AA Change: L689P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000063272
Gene: ENSMUSG00000020412
AA Change: L689P

DomainStartEndE-ValueType
CUE 465 507 7.59e-11 SMART
low complexity region 599 614 N/A INTRINSIC
low complexity region 648 663 N/A INTRINSIC
low complexity region 718 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109930
AA Change: L649P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105556
Gene: ENSMUSG00000020412
AA Change: L649P

DomainStartEndE-ValueType
CUE 465 507 7.59e-11 SMART
low complexity region 559 574 N/A INTRINSIC
low complexity region 608 623 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Ascc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Ascc2 APN 11 4640481 critical splice donor site probably null
R0485:Ascc2 UTSW 11 4672302 missense probably benign 0.01
R0632:Ascc2 UTSW 11 4649855 missense probably damaging 1.00
R0690:Ascc2 UTSW 11 4682933 missense probably damaging 1.00
R0942:Ascc2 UTSW 11 4668380 missense probably benign 0.31
R1893:Ascc2 UTSW 11 4672305 missense probably benign 0.01
R1991:Ascc2 UTSW 11 4679257 missense probably benign
R2062:Ascc2 UTSW 11 4681496 missense probably benign
R2063:Ascc2 UTSW 11 4681496 missense probably benign
R2065:Ascc2 UTSW 11 4681496 missense probably benign
R2067:Ascc2 UTSW 11 4681496 missense probably benign
R2068:Ascc2 UTSW 11 4681496 missense probably benign
R2292:Ascc2 UTSW 11 4679352 splice site probably benign
R3076:Ascc2 UTSW 11 4672446 missense probably damaging 1.00
R4436:Ascc2 UTSW 11 4656305 missense probably damaging 1.00
R4783:Ascc2 UTSW 11 4646653 missense probably benign 0.01
R5211:Ascc2 UTSW 11 4673399 missense possibly damaging 0.95
R5395:Ascc2 UTSW 11 4659273 missense possibly damaging 0.92
R5859:Ascc2 UTSW 11 4658284 missense probably benign 0.11
R7569:Ascc2 UTSW 11 4679506 missense probably damaging 1.00
X0011:Ascc2 UTSW 11 4658297 missense probably benign
Z1088:Ascc2 UTSW 11 4646656 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATACTCCCTGTGGTGTGC -3'
(R):5'- CACTTCATCTTTAGGCAGCAC -3'

Sequencing Primer
(F):5'- AACCCGTGCCCTTTGTGG -3'
(R):5'- CTTCATCTTTAGGCAGCACTTAATG -3'
Posted On2017-02-28