Incidental Mutation 'R5917:Dact1'
ID461422
Institutional Source Beutler Lab
Gene Symbol Dact1
Ensembl Gene ENSMUSG00000044548
Gene Namedishevelled-binding antagonist of beta-catenin 1
SynonymsFrodo, Dapper1, Frodo1, THYEX3, Frd1
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71309884-71320107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71318682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 746 (V746L)
Ref Sequence ENSEMBL: ENSMUSP00000117169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061273] [ENSMUST00000150639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061273
AA Change: V709L

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058943
Gene: ENSMUSG00000044548
AA Change: V709L

DomainStartEndE-ValueType
Pfam:Dapper 39 206 4.1e-83 PFAM
Pfam:Dapper 204 778 7.8e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132822
Predicted Effect possibly damaging
Transcript: ENSMUST00000150639
AA Change: V746L

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117169
Gene: ENSMUSG00000044548
AA Change: V746L

DomainStartEndE-ValueType
Pfam:Dapper 39 815 1.4e-240 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, abnormal embryogenesis, blind-ended colons, and abnormal renal/urinary system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Dact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Dact1 APN 12 71317483 missense probably damaging 1.00
R0930:Dact1 UTSW 12 71318460 missense probably damaging 1.00
R1590:Dact1 UTSW 12 71317575 missense probably benign 0.34
R1669:Dact1 UTSW 12 71318773 missense probably damaging 1.00
R1694:Dact1 UTSW 12 71312777 missense probably damaging 1.00
R1826:Dact1 UTSW 12 71318344 missense probably damaging 1.00
R4398:Dact1 UTSW 12 71317185 missense probably damaging 1.00
R5028:Dact1 UTSW 12 71318573 nonsense probably null
R6432:Dact1 UTSW 12 71318553 missense probably damaging 1.00
R6473:Dact1 UTSW 12 71317698 missense probably benign 0.00
R6759:Dact1 UTSW 12 71318137 nonsense probably null
R6823:Dact1 UTSW 12 71317939 missense probably benign 0.10
X0025:Dact1 UTSW 12 71317852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTCTCCTACGAAGAAGC -3'
(R):5'- ACGGAGGATCTTCTTCTTGAGG -3'

Sequencing Primer
(F):5'- GTCTCCTACGAAGAAGCCCTGC -3'
(R):5'- ATCTTCTTCTTGAGGTTGTGCGAAG -3'
Posted On2017-02-28