Incidental Mutation 'R5917:Zfp521'
ID461432
Institutional Source Beutler Lab
Gene Symbol Zfp521
Ensembl Gene ENSMUSG00000024420
Gene Namezinc finger protein 521
SynonymsB930086A16Rik, Evi3
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location13687013-13972733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13845555 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 600 (K600N)
Ref Sequence ENSEMBL: ENSMUSP00000025288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025288]
Predicted Effect probably damaging
Transcript: ENSMUST00000025288
AA Change: K600N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025288
Gene: ENSMUSG00000024420
AA Change: K600N

DomainStartEndE-ValueType
ZnF_C2H2 47 68 3.47e1 SMART
low complexity region 82 100 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 118 140 3.89e-3 SMART
ZnF_C2H2 146 168 1.33e-1 SMART
ZnF_C2H2 174 196 1.38e-3 SMART
ZnF_C2H2 202 224 2.36e-2 SMART
ZnF_C2H2 246 269 6.57e-1 SMART
ZnF_C2H2 281 304 3.52e-1 SMART
ZnF_C2H2 310 332 1.76e-1 SMART
low complexity region 345 358 N/A INTRINSIC
ZnF_C2H2 405 429 4.34e-1 SMART
ZnF_C2H2 437 460 6.23e-2 SMART
ZnF_C2H2 477 500 8.94e-3 SMART
ZnF_C2H2 513 536 5.42e-2 SMART
ZnF_C2H2 560 585 1.86e0 SMART
ZnF_C2H2 634 656 1.12e-3 SMART
ZnF_C2H2 664 686 2.12e-4 SMART
ZnF_C2H2 694 717 6.42e-4 SMART
ZnF_C2H2 722 745 7.78e-3 SMART
ZnF_C2H2 752 775 6.32e-3 SMART
ZnF_C2H2 783 805 2.05e-2 SMART
ZnF_C2H2 809 832 4.72e-2 SMART
ZnF_C2H2 886 909 1.86e0 SMART
ZnF_C2H2 930 952 3.04e-5 SMART
ZnF_C2H2 959 981 6.42e-4 SMART
ZnF_C2H2 988 1010 7.49e0 SMART
ZnF_C2H2 1020 1042 4.99e1 SMART
Blast:RING 1067 1098 1e-9 BLAST
low complexity region 1099 1119 N/A INTRINSIC
ZnF_C2H2 1138 1161 1.79e-2 SMART
ZnF_C2H2 1195 1217 2.53e-2 SMART
ZnF_C2H2 1225 1247 2.32e-1 SMART
ZnF_C2H2 1256 1279 2.91e-2 SMART
ZnF_C2H2 1286 1309 5.72e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit postnatal growth retardation, behavioral anomalies including hyperlocomotion, lower anxiety, higher impulsivity and impaired learning, abnormal formation of the neuronal cell layers of the dentate gyrus in the hippocampus, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Zfp521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Zfp521 APN 18 13846502 missense probably benign 0.15
IGL00499:Zfp521 APN 18 13939120 missense probably benign 0.25
IGL01291:Zfp521 APN 18 13817246 missense probably damaging 1.00
IGL01335:Zfp521 APN 18 13844719 missense probably benign 0.31
IGL01384:Zfp521 APN 18 13843923 missense probably benign 0.26
IGL01520:Zfp521 APN 18 13938988 missense possibly damaging 0.92
IGL02248:Zfp521 APN 18 13844246 missense possibly damaging 0.93
IGL02640:Zfp521 APN 18 13844930 missense probably benign 0.00
ANU05:Zfp521 UTSW 18 13817246 missense probably damaging 1.00
R0113:Zfp521 UTSW 18 13845091 missense probably damaging 1.00
R0197:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R0457:Zfp521 UTSW 18 13844840 missense probably benign
R0494:Zfp521 UTSW 18 13845268 missense probably damaging 1.00
R0494:Zfp521 UTSW 18 13846870 missense probably damaging 1.00
R0883:Zfp521 UTSW 18 13845062 missense probably benign 0.00
R2133:Zfp521 UTSW 18 13844705 missense possibly damaging 0.88
R2263:Zfp521 UTSW 18 13846240 missense possibly damaging 0.89
R3699:Zfp521 UTSW 18 13846273 nonsense probably null
R3760:Zfp521 UTSW 18 13844629 missense possibly damaging 0.93
R3851:Zfp521 UTSW 18 13717751 splice site probably benign
R3950:Zfp521 UTSW 18 13846346 missense probably damaging 0.99
R4398:Zfp521 UTSW 18 13846544 missense probably benign 0.26
R4583:Zfp521 UTSW 18 13844330 missense probably benign 0.19
R4688:Zfp521 UTSW 18 13844590 missense probably damaging 1.00
R4688:Zfp521 UTSW 18 13844591 nonsense probably null
R4698:Zfp521 UTSW 18 13845603 missense probably damaging 0.96
R4738:Zfp521 UTSW 18 13844054 missense possibly damaging 0.50
R5031:Zfp521 UTSW 18 13844273 missense possibly damaging 0.68
R5137:Zfp521 UTSW 18 13845448 missense probably damaging 1.00
R5257:Zfp521 UTSW 18 13846978 missense probably damaging 1.00
R5420:Zfp521 UTSW 18 13844087 missense probably damaging 1.00
R5995:Zfp521 UTSW 18 13717624 missense probably damaging 1.00
R6088:Zfp521 UTSW 18 13846109 missense possibly damaging 0.47
R6150:Zfp521 UTSW 18 13844078 missense probably damaging 1.00
R6261:Zfp521 UTSW 18 13844627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGTTTTGGCAGCACG -3'
(R):5'- AGACAGGTCCATTGTGACCTC -3'

Sequencing Primer
(F):5'- GCAGCACGGTGTCCAAATG -3'
(R):5'- CAGGTCCATTGTGACCTCAGTGG -3'
Posted On2017-02-28