Incidental Mutation 'R5918:Vmn1r175'
ID461463
Institutional Source Beutler Lab
Gene Symbol Vmn1r175
Ensembl Gene ENSMUSG00000095632
Gene Namevomeronasal 1 receptor 175
SynonymsGm6299
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5918 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23807182-23810643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23808947 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 85 (D85A)
Ref Sequence ENSEMBL: ENSMUSP00000154170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166141] [ENSMUST00000228383]
Predicted Effect probably damaging
Transcript: ENSMUST00000166141
AA Change: D85A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126357
Gene: ENSMUSG00000095632
AA Change: D85A

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 8.8e-15 PFAM
Pfam:7tm_1 13 285 2.5e-6 PFAM
Pfam:V1R 41 295 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228383
AA Change: D85A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0396 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Vmn1r175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02944:Vmn1r175 APN 7 23809166 missense probably damaging 0.97
R1163:Vmn1r175 UTSW 7 23808512 missense probably benign 0.30
R1901:Vmn1r175 UTSW 7 23808793 missense probably benign 0.00
R1926:Vmn1r175 UTSW 7 23809041 missense possibly damaging 0.81
R1957:Vmn1r175 UTSW 7 23808383 missense probably benign 0.21
R2163:Vmn1r175 UTSW 7 23808927 missense probably benign 0.29
R2381:Vmn1r175 UTSW 7 23808668 missense probably benign 0.31
R3109:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R3419:Vmn1r175 UTSW 7 23808650 missense probably damaging 0.96
R3941:Vmn1r175 UTSW 7 23808968 missense probably benign 0.00
R4982:Vmn1r175 UTSW 7 23809069 missense possibly damaging 0.61
R5191:Vmn1r175 UTSW 7 23809022 missense possibly damaging 0.91
R5326:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5333:Vmn1r175 UTSW 7 23808579 missense possibly damaging 0.69
R5476:Vmn1r175 UTSW 7 23809131 missense possibly damaging 0.82
R5542:Vmn1r175 UTSW 7 23809106 missense possibly damaging 0.88
R5761:Vmn1r175 UTSW 7 23808480 missense probably benign 0.01
R6163:Vmn1r175 UTSW 7 23809166 missense possibly damaging 0.71
R6563:Vmn1r175 UTSW 7 23808605 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CATTGACTTTCATTGGAATGTGAGC -3'
(R):5'- GGTTTGGGACTGCAGTCAAC -3'

Sequencing Primer
(F):5'- GCATTATTTAAGACACTGAACAACC -3'
(R):5'- GGGACTGCAGTCAACATTTTTC -3'
Posted On2017-02-28