Incidental Mutation 'R5918:Srcin1'
ID461485
Institutional Source Beutler Lab
Gene Symbol Srcin1
Ensembl Gene ENSMUSG00000038453
Gene NameSRC kinase signaling inhibitor 1
Synonymsp140Cap, P140
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R5918 (G1)
Quality Score224
Status Validated
Chromosome11
Chromosomal Location97509340-97576186 bp(-) (GRCm38)
Type of Mutationunclassified (1390 bp from exon)
DNA Base Change (assembly) T to C at 97533497 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107590] [ENSMUST00000107593] [ENSMUST00000107596] [ENSMUST00000126287]
Predicted Effect probably benign
Transcript: ENSMUST00000107590
AA Change: E636G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453
AA Change: E636G

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107593
AA Change: E636G

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453
AA Change: E636G

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107596
AA Change: E635G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453
AA Change: E635G

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126287
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in object recognition memory and motor learning, dendritic spine disorganization, impaired synaptic plasticity, and reduced long term potentiation and long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Srcin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Srcin1 APN 11 97533098 missense possibly damaging 0.81
IGL03347:Srcin1 APN 11 97525344 missense probably damaging 1.00
R1619:Srcin1 UTSW 11 97525481 missense probably damaging 1.00
R1678:Srcin1 UTSW 11 97518644 missense probably damaging 0.99
R1733:Srcin1 UTSW 11 97533501 missense probably benign
R2023:Srcin1 UTSW 11 97526046 missense probably benign
R2238:Srcin1 UTSW 11 97534819 missense probably benign 0.00
R3983:Srcin1 UTSW 11 97525553 missense probably damaging 1.00
R4572:Srcin1 UTSW 11 97534934 missense probably damaging 1.00
R4628:Srcin1 UTSW 11 97548926 missense probably benign 0.12
R4946:Srcin1 UTSW 11 97551942 missense probably damaging 1.00
R5175:Srcin1 UTSW 11 97573877 missense probably damaging 0.99
R5424:Srcin1 UTSW 11 97537059 nonsense probably null
R5705:Srcin1 UTSW 11 97548951 missense probably benign 0.42
R6563:Srcin1 UTSW 11 97534774 missense possibly damaging 0.74
R6613:Srcin1 UTSW 11 97533827 missense possibly damaging 0.94
R6756:Srcin1 UTSW 11 97535010 missense probably damaging 1.00
R6805:Srcin1 UTSW 11 97551980 critical splice acceptor site probably null
R7060:Srcin1 UTSW 11 97573885 missense probably damaging 0.99
X0024:Srcin1 UTSW 11 97536468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTATGACTGTCTACCCCAAG -3'
(R):5'- ACTGTCAGGGCCTGAGTTTG -3'

Sequencing Primer
(F):5'- ATGACTGTCTACCCCAAGTGATG -3'
(R):5'- GTGAGCTAAATTAGAAGCCCTGTGTC -3'
Posted On2017-02-28