Incidental Mutation 'R5920:Chd2'
ID461522
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission 044117-MU
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R5920 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73537312 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 33 (L33P)
Ref Sequence ENSEMBL: ENSMUSP00000134484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000172704] [ENSMUST00000197642]
Predicted Effect probably benign
Transcript: ENSMUST00000026895
SMART Domains Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
CHROMO 224 310 2.3e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169922
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172704
AA Change: L33P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134484
Gene: ENSMUSG00000078671
AA Change: L33P

DomainStartEndE-ValueType
low complexity region 34 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184587
Predicted Effect probably benign
Transcript: ENSMUST00000197642
SMART Domains Protein: ENSMUSP00000142408
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
Blast:CHROMO 1 58 5e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206776
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 intron probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 unclassified probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTACAGCCAAGGCATTTCAAG -3'
(R):5'- CCCATTGGTTGAAAGCAGTTCAG -3'

Sequencing Primer
(F):5'- GGCATTTCAAGACCTTACCAAG -3'
(R):5'- AAGCAGTTCAGTGTGAGTGTAATG -3'
Posted On2017-02-28