Incidental Mutation 'R5920:Olfr517'
ID461524
Institutional Source Beutler Lab
Gene Symbol Olfr517
Ensembl Gene ENSMUSG00000066240
Gene Nameolfactory receptor 517
SynonymsGA_x6K02T2PBJ9-11199311-11198367, MOR268-4
MMRRC Submission 044117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5920 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108867208-108872379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108868688 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 155 (M155I)
Ref Sequence ENSEMBL: ENSMUSP00000150980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084753] [ENSMUST00000216500]
Predicted Effect probably benign
Transcript: ENSMUST00000084753
AA Change: M155I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081805
Gene: ENSMUSG00000066240
AA Change: M155I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.4e-60 PFAM
Pfam:7tm_1 41 299 4.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207346
Predicted Effect probably benign
Transcript: ENSMUST00000216500
AA Change: M155I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Olfr517
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Olfr517 APN 7 108868275 missense possibly damaging 0.94
IGL01866:Olfr517 APN 7 108868799 missense possibly damaging 0.95
IGL02131:Olfr517 APN 7 108868208 makesense probably null
IGL02456:Olfr517 APN 7 108869050 missense probably benign 0.19
IGL02604:Olfr517 APN 7 108868650 missense probably benign 0.00
IGL02975:Olfr517 APN 7 108868855 nonsense probably null
R0084:Olfr517 UTSW 7 108868800 missense probably damaging 0.98
R0504:Olfr517 UTSW 7 108868850 missense possibly damaging 0.91
R0748:Olfr517 UTSW 7 108869150 start codon destroyed probably null 1.00
R1428:Olfr517 UTSW 7 108868960 missense probably damaging 0.99
R1907:Olfr517 UTSW 7 108868498 missense possibly damaging 0.78
R2292:Olfr517 UTSW 7 108869016 missense probably benign 0.05
R3874:Olfr517 UTSW 7 108869128 missense probably damaging 0.98
R4091:Olfr517 UTSW 7 108868443 missense probably damaging 1.00
R4873:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R4875:Olfr517 UTSW 7 108868786 missense probably damaging 0.99
R5440:Olfr517 UTSW 7 108868626 missense probably damaging 1.00
R6723:Olfr517 UTSW 7 108868588 missense probably damaging 1.00
R6730:Olfr517 UTSW 7 108868573 missense probably benign 0.09
R6892:Olfr517 UTSW 7 108868515 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTGTAGTGGATGGCATC -3'
(R):5'- AGCGACCATTTCCTTTGGG -3'

Sequencing Primer
(F):5'- CCCTGTAGTGGATGGCATCTTCAG -3'
(R):5'- ACCATTTCCTTTGGGGGCTG -3'
Posted On2017-02-28