Incidental Mutation 'R5920:Dcdc2c'
ID461534
Institutional Source Beutler Lab
Gene Symbol Dcdc2c
Ensembl Gene ENSMUSG00000020633
Gene Namedoublecortin domain containing 2C
Synonyms1110015M06Rik
MMRRC Submission 044117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5920 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location28437795-28552399 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28535537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 154 (I154V)
Ref Sequence ENSEMBL: ENSMUSP00000152233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020963] [ENSMUST00000189735] [ENSMUST00000221349]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020963
AA Change: I154V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020963
Gene: ENSMUSG00000020633
AA Change: I154V

DomainStartEndE-ValueType
DCX 11 98 2.16e-29 SMART
DCX 131 217 6.18e-7 SMART
low complexity region 302 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185916
AA Change: I86V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000189735
SMART Domains Protein: ENSMUSP00000140603
Gene: ENSMUSG00000020633

DomainStartEndE-ValueType
Pfam:DCX 1 44 1.5e-9 PFAM
low complexity region 134 148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221349
AA Change: I154V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Dcdc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Dcdc2c APN 12 28535545 missense probably benign 0.03
R1214:Dcdc2c UTSW 12 28530430 nonsense probably null
R3040:Dcdc2c UTSW 12 28552182 missense probably damaging 1.00
R4937:Dcdc2c UTSW 12 28530473 missense possibly damaging 0.69
R5268:Dcdc2c UTSW 12 28516657 missense possibly damaging 0.83
R5921:Dcdc2c UTSW 12 28524775 missense possibly damaging 0.90
R6444:Dcdc2c UTSW 12 28535476 missense probably damaging 1.00
R6939:Dcdc2c UTSW 12 28541497 missense probably benign 0.09
R7044:Dcdc2c UTSW 12 28470494 utr 3 prime probably benign
R7235:Dcdc2c UTSW 12 28470719 missense
R7287:Dcdc2c UTSW 12 28516686 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGCACAGCTCAATGTTTG -3'
(R):5'- AGACTGCTCTGTAGGACTCC -3'

Sequencing Primer
(F):5'- GCACAGCTCAATGTTTGTTGAATAG -3'
(R):5'- GAATACAGTGTTCCCTCTC -3'
Posted On2017-02-28