Incidental Mutation 'R5920:Eif2b5'
ID461540
Institutional Source Beutler Lab
Gene Symbol Eif2b5
Ensembl Gene ENSMUSG00000003235
Gene Nameeukaryotic translation initiation factor 2B, subunit 5 epsilon
Synonyms
MMRRC Submission 044117-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5920 (G1)
Quality Score114
Status Not validated
Chromosome16
Chromosomal Location20498817-20509323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20498944 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 11 (A11S)
Ref Sequence ENSEMBL: ENSMUSP00000003320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003320]
Predicted Effect unknown
Transcript: ENSMUST00000003320
AA Change: A11S
SMART Domains Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: A11S

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:Hexapep 341 372 9.8e-5 PFAM
Pfam:Hexapep 361 389 6.1e-6 PFAM
low complexity region 517 526 N/A INTRINSIC
eIF5C 625 712 8.43e-31 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Eif2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Eif2b5 APN 16 20505252 missense probably benign 0.19
IGL01073:Eif2b5 APN 16 20500296 nonsense probably null
IGL01467:Eif2b5 APN 16 20508964 nonsense probably null
IGL02754:Eif2b5 APN 16 20502786 missense possibly damaging 0.50
IGL03286:Eif2b5 APN 16 20502262 missense probably damaging 1.00
R0569:Eif2b5 UTSW 16 20502553 missense probably benign 0.13
R1321:Eif2b5 UTSW 16 20504689 nonsense probably null
R1647:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1648:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1897:Eif2b5 UTSW 16 20507037 missense probably damaging 0.99
R2231:Eif2b5 UTSW 16 20504770 missense probably benign
R3196:Eif2b5 UTSW 16 20505522 missense probably benign
R4423:Eif2b5 UTSW 16 20501719 missense probably benign 0.10
R4776:Eif2b5 UTSW 16 20500233 missense probably damaging 1.00
R5240:Eif2b5 UTSW 16 20501398 missense possibly damaging 0.49
R5828:Eif2b5 UTSW 16 20502786 missense possibly damaging 0.50
R5925:Eif2b5 UTSW 16 20508124 missense probably benign 0.02
R6717:Eif2b5 UTSW 16 20505283 missense probably damaging 0.96
R6915:Eif2b5 UTSW 16 20502750 missense possibly damaging 0.83
R7396:Eif2b5 UTSW 16 20506137 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCTGCTGGTACACACATGC -3'
(R):5'- CACGCTTCACTAACCAGCTG -3'

Sequencing Primer
(F):5'- GCTGGTACACACATGCGCATTC -3'
(R):5'- TTCACTAACCAGCTGCAGTGG -3'
Posted On2017-02-28