Incidental Mutation 'R5921:Rxrg'
ID461551
Institutional Source Beutler Lab
Gene Symbol Rxrg
Ensembl Gene ENSMUSG00000015843
Gene Nameretinoid X receptor gamma
SynonymsNr2b3
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location167598384-167639623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167639239 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 330 (M330T)
Ref Sequence ENSEMBL: ENSMUSP00000107011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015987] [ENSMUST00000111380] [ENSMUST00000111384] [ENSMUST00000111386]
Predicted Effect probably benign
Transcript: ENSMUST00000015987
AA Change: M453T

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000015987
Gene: ENSMUSG00000015843
AA Change: M453T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 25 134 1.2e-39 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111380
AA Change: M330T

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107011
Gene: ENSMUSG00000015843
AA Change: M330T

DomainStartEndE-ValueType
ZnF_C4 13 84 6.92e-39 SMART
HOLI 148 307 2.7e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111384
AA Change: M453T

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107015
Gene: ENSMUSG00000015843
AA Change: M453T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111386
AA Change: M453T

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107017
Gene: ENSMUSG00000015843
AA Change: M453T

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 24 134 3.4e-35 PFAM
ZnF_C4 136 207 6.92e-39 SMART
HOLI 271 430 2.7e-50 SMART
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Targeted disruption of exon 2 causes a 25% reduction of neurons in the striatum and may lead to premature death and altered responses to the administration of dopamine antagonists on some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Rxrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Rxrg APN 1 167627288 splice site probably benign
IGL01767:Rxrg APN 1 167627315 missense probably damaging 1.00
IGL02126:Rxrg APN 1 167634460 missense probably damaging 0.98
IGL03144:Rxrg APN 1 167598758 missense possibly damaging 0.53
R0482:Rxrg UTSW 1 167631037 missense possibly damaging 0.94
R0548:Rxrg UTSW 1 167631219 splice site probably benign
R0734:Rxrg UTSW 1 167627444 missense probably damaging 1.00
R1294:Rxrg UTSW 1 167613901 missense probably benign
R1843:Rxrg UTSW 1 167598752 start codon destroyed probably benign 0.02
R2093:Rxrg UTSW 1 167627324 missense probably damaging 1.00
R2972:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R2974:Rxrg UTSW 1 167639146 missense probably damaging 1.00
R3177:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R3277:Rxrg UTSW 1 167635700 missense possibly damaging 0.64
R4484:Rxrg UTSW 1 167625027 missense probably benign 0.03
R4721:Rxrg UTSW 1 167625052 missense probably damaging 1.00
R5267:Rxrg UTSW 1 167635766 missense probably damaging 0.98
R5323:Rxrg UTSW 1 167625004 missense probably benign
R5858:Rxrg UTSW 1 167627356 missense probably damaging 1.00
R6142:Rxrg UTSW 1 167632622 missense possibly damaging 0.69
R6370:Rxrg UTSW 1 167634437 missense probably damaging 1.00
R6595:Rxrg UTSW 1 167627336 missense probably damaging 1.00
R6702:Rxrg UTSW 1 167613805 missense probably benign
R7133:Rxrg UTSW 1 167631109 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAGACCCATCAGGCAGTCTC -3'
(R):5'- GCCACCTTTAACAGCCGTAC -3'

Sequencing Primer
(F):5'- CGACAGTAGGTGTGTTTCT -3'
(R):5'- CCACCTAGAAAAGTCTCATGTGTAG -3'
Posted On2017-02-28