Incidental Mutation 'R5921:Stk39'
ID461552
Institutional Source Beutler Lab
Gene Symbol Stk39
Ensembl Gene ENSMUSG00000027030
Gene Nameserine/threonine kinase 39
SynonymsDCHT, Rnl5, RF005, SPAK
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68210445-68472268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68366105 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000099776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102715]
Predicted Effect probably damaging
Transcript: ENSMUST00000102715
AA Change: S327P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099776
Gene: ENSMUSG00000027030
AA Change: S327P

DomainStartEndE-ValueType
low complexity region 14 65 N/A INTRINSIC
S_TKc 75 349 4.44e-80 SMART
Pfam:OSR1_C 463 494 1.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149581
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced bumetanide-sensitive thallium, a potassium tracer, uptake in dorsal root ganglion neurons and reduced fertility. Mice with an ENU mutation in intron 8 exhibit elevated albumin-creatinine (ACR) ratios. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Stk39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Stk39 APN 2 68314564 missense possibly damaging 0.81
IGL00966:Stk39 APN 2 68211958 missense probably benign 0.01
IGL01936:Stk39 APN 2 68314564 missense probably benign 0.21
IGL02301:Stk39 APN 2 68211962 missense probably damaging 1.00
IGL02940:Stk39 APN 2 68220899 splice site probably null
R0570:Stk39 UTSW 2 68410048 missense probably damaging 1.00
R0609:Stk39 UTSW 2 68366167 missense probably damaging 1.00
R0670:Stk39 UTSW 2 68366182 missense possibly damaging 0.93
R0980:Stk39 UTSW 2 68392171 missense probably damaging 1.00
R1024:Stk39 UTSW 2 68410046 missense probably damaging 1.00
R1573:Stk39 UTSW 2 68390949 missense probably damaging 1.00
R1713:Stk39 UTSW 2 68307116 splice site probably benign
R2223:Stk39 UTSW 2 68314579 missense probably damaging 0.96
R3700:Stk39 UTSW 2 68392118 missense probably damaging 1.00
R4207:Stk39 UTSW 2 68220920 missense probably benign 0.42
R4298:Stk39 UTSW 2 68390940 missense probably damaging 1.00
R4726:Stk39 UTSW 2 68263303 missense probably damaging 1.00
R4975:Stk39 UTSW 2 68220992 intron probably benign
R5057:Stk39 UTSW 2 68220948 missense probably damaging 0.99
R5384:Stk39 UTSW 2 68410039 missense probably damaging 1.00
R6125:Stk39 UTSW 2 68392124 missense probably damaging 1.00
R6251:Stk39 UTSW 2 68307039 critical splice donor site probably null
R6332:Stk39 UTSW 2 68410043 missense possibly damaging 0.93
R6375:Stk39 UTSW 2 68392238 missense probably benign 0.34
R7057:Stk39 UTSW 2 68410127 missense possibly damaging 0.88
R7064:Stk39 UTSW 2 68358812 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGATCAATTCTTCCTCCAC -3'
(R):5'- AGTGCTTTGTGTGGAAACGC -3'

Sequencing Primer
(F):5'- AGTGCTACACCGGCTTCTC -3'
(R):5'- TGTGTGGAAACGCTGAAACTTCC -3'
Posted On2017-02-28