Incidental Mutation 'R5921:Hsd3b1'
ID461559
Institutional Source Beutler Lab
Gene Symbol Hsd3b1
Ensembl Gene ENSMUSG00000027871
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
SynonymsD3Ertd383e
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98852194-98859794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98857899 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 22 (M22I)
Ref Sequence ENSEMBL: ENSMUSP00000102630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029465] [ENSMUST00000107016]
Predicted Effect probably benign
Transcript: ENSMUST00000029465
AA Change: M22I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029465
Gene: ENSMUSG00000027871
AA Change: M22I

DomainStartEndE-ValueType
Pfam:Epimerase 24 248 3.8e-23 PFAM
Pfam:NAD_binding_4 25 226 3.4e-18 PFAM
Pfam:Polysacc_synt_2 30 129 1.3e-8 PFAM
Pfam:3Beta_HSD 34 282 1.8e-102 PFAM
Pfam:NAD_binding_10 35 228 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107016
AA Change: M22I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102630
Gene: ENSMUSG00000027871
AA Change: M22I

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 264 4.3e-8 PFAM
Pfam:KR 5 133 1.1e-7 PFAM
Pfam:Ldh_1_N 5 135 4.3e-7 PFAM
Pfam:Polysacc_synt_2 6 136 3e-14 PFAM
Pfam:NmrA 6 138 6.2e-10 PFAM
Pfam:Epimerase 6 250 2.9e-30 PFAM
Pfam:GDP_Man_Dehyd 7 216 6.6e-16 PFAM
Pfam:3Beta_HSD 7 288 2.1e-122 PFAM
Pfam:NAD_binding_4 8 219 4e-21 PFAM
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Hsd3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Hsd3b1 APN 3 98853246 missense probably damaging 1.00
IGL01955:Hsd3b1 APN 3 98853147 missense probably benign 0.08
IGL02894:Hsd3b1 APN 3 98852929 missense possibly damaging 0.88
IGL03136:Hsd3b1 APN 3 98852985 missense probably damaging 1.00
R0265:Hsd3b1 UTSW 3 98852773 missense probably damaging 1.00
R0326:Hsd3b1 UTSW 3 98853274 missense probably damaging 1.00
R0390:Hsd3b1 UTSW 3 98853039 missense probably damaging 1.00
R1532:Hsd3b1 UTSW 3 98852898 missense probably damaging 1.00
R2845:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2846:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2898:Hsd3b1 UTSW 3 98853307 missense probably benign 0.00
R3153:Hsd3b1 UTSW 3 98852664 missense probably damaging 0.99
R3950:Hsd3b1 UTSW 3 98856138 missense possibly damaging 0.79
R4456:Hsd3b1 UTSW 3 98856143 missense probably benign 0.01
R4792:Hsd3b1 UTSW 3 98852910 missense probably benign 0.22
R4799:Hsd3b1 UTSW 3 98852865 missense probably benign 0.07
R4898:Hsd3b1 UTSW 3 98853326 missense probably benign 0.12
R5512:Hsd3b1 UTSW 3 98853205 missense probably benign 0.06
R5834:Hsd3b1 UTSW 3 98852939 missense possibly damaging 0.60
R6221:Hsd3b1 UTSW 3 98853156 missense probably benign 0.00
R6918:Hsd3b1 UTSW 3 98853109 missense probably damaging 0.98
R7058:Hsd3b1 UTSW 3 98857815 splice site probably null
R7242:Hsd3b1 UTSW 3 98853210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGAGGGCTTCCATATTTGC -3'
(R):5'- CTTGCTGCTGCTGTGATCAC -3'

Sequencing Primer
(F):5'- GAGGGCTTCCATATTTGCTAGAAAAG -3'
(R):5'- GTAGAGTGAATCCCAGAGATTTCTG -3'
Posted On2017-02-28