Incidental Mutation 'R5921:Uvssa'
ID461568
Institutional Source Beutler Lab
Gene Symbol Uvssa
Ensembl Gene ENSMUSG00000037355
Gene NameUV stimulated scaffold protein A
SynonymsD330017J19Rik, 4933407H18Rik
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33378549-33419754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33389752 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 221 (S221P)
Ref Sequence ENSEMBL: ENSMUSP00000144400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087864] [ENSMUST00000202046] [ENSMUST00000202816]
Predicted Effect probably benign
Transcript: ENSMUST00000087864
AA Change: S221P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000085170
Gene: ENSMUSG00000037355
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200682
Predicted Effect probably benign
Transcript: ENSMUST00000202046
AA Change: S221P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144025
Gene: ENSMUSG00000037355
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202816
AA Change: S221P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144400
Gene: ENSMUSG00000037355
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Uvssa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Uvssa APN 5 33408848 missense probably benign 0.00
IGL02136:Uvssa APN 5 33391848 missense probably damaging 1.00
IGL02339:Uvssa APN 5 33414849 missense probably damaging 1.00
IGL03096:Uvssa APN 5 33410924 missense probably benign 0.29
IGL03130:Uvssa APN 5 33391845 missense possibly damaging 0.57
IGL03248:Uvssa APN 5 33391816 missense probably damaging 1.00
PIT1430001:Uvssa UTSW 5 33402570 missense possibly damaging 0.50
PIT4142001:Uvssa UTSW 5 33392084 missense probably benign 0.05
R0326:Uvssa UTSW 5 33408847 missense probably benign 0.01
R0443:Uvssa UTSW 5 33388824 missense possibly damaging 0.68
R1438:Uvssa UTSW 5 33413884 splice site probably benign
R1474:Uvssa UTSW 5 33388821 missense probably benign 0.00
R1521:Uvssa UTSW 5 33413934 missense probably damaging 0.99
R1522:Uvssa UTSW 5 33387808 missense probably damaging 1.00
R1839:Uvssa UTSW 5 33389752 missense probably benign 0.00
R2223:Uvssa UTSW 5 33392063 missense probably damaging 1.00
R3404:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3405:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3406:Uvssa UTSW 5 33389818 missense probably damaging 0.99
R3892:Uvssa UTSW 5 33389752 missense probably benign 0.04
R4624:Uvssa UTSW 5 33389956 missense possibly damaging 0.87
R4898:Uvssa UTSW 5 33413913 nonsense probably null
R5413:Uvssa UTSW 5 33410908 missense probably damaging 1.00
R5977:Uvssa UTSW 5 33389860 missense probably damaging 1.00
R6198:Uvssa UTSW 5 33409510 missense probably damaging 1.00
R6566:Uvssa UTSW 5 33392176 missense possibly damaging 0.66
R6884:Uvssa UTSW 5 33409117 intron probably null
Predicted Primers PCR Primer
(F):5'- AATATCATGTCCCCTTGGTGTC -3'
(R):5'- TCCCTGGAGGAGTCTTTCATG -3'

Sequencing Primer
(F):5'- GAAGCAGTCTTGGCCATCTG -3'
(R):5'- AGGAGTCTTTCATGGCTGTTTG -3'
Posted On2017-02-28