Incidental Mutation 'R5921:Ociad1'
ID461572
Institutional Source Beutler Lab
Gene Symbol Ociad1
Ensembl Gene ENSMUSG00000029152
Gene NameOCIA domain containing 1
SynonymsB230209J16Rik, Emi2, TPA018, 6030432N09Rik, Imi2, expressed during mesenchymal induction 2, Asrij
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73292784-73314069 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73310382 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000144102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031038] [ENSMUST00000071081] [ENSMUST00000166823] [ENSMUST00000200935] [ENSMUST00000201556] [ENSMUST00000201739] [ENSMUST00000202237] [ENSMUST00000202250]
Predicted Effect probably benign
Transcript: ENSMUST00000031038
AA Change: D221G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031038
Gene: ENSMUSG00000029152
AA Change: D221G

DomainStartEndE-ValueType
Pfam:OCIA 8 112 8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071081
SMART Domains Protein: ENSMUSP00000069412
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166823
SMART Domains Protein: ENSMUSP00000128805
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200935
SMART Domains Protein: ENSMUSP00000144515
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201272
Predicted Effect probably benign
Transcript: ENSMUST00000201556
SMART Domains Protein: ENSMUSP00000144227
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201739
Predicted Effect probably benign
Transcript: ENSMUST00000202237
AA Change: D167G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144102
Gene: ENSMUSG00000029152
AA Change: D167G

DomainStartEndE-ValueType
Pfam:OCIA 1 58 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202250
SMART Domains Protein: ENSMUSP00000143799
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202887
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Ociad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ociad1 APN 5 73304543 splice site probably benign
IGL00801:Ociad1 APN 5 73304566 missense probably damaging 1.00
IGL02402:Ociad1 APN 5 73300694 missense possibly damaging 0.72
IGL03197:Ociad1 APN 5 73294332 missense probably benign 0.00
Bequerel UTSW 5 73310382 missense probably benign 0.01
Curie UTSW 5 73310345 nonsense probably null
R0420:Ociad1 UTSW 5 73313429 splice site probably null
R0707:Ociad1 UTSW 5 73294912 splice site probably benign
R1130:Ociad1 UTSW 5 73294332 missense probably benign 0.00
R1744:Ociad1 UTSW 5 73300719 critical splice donor site probably null
R2848:Ociad1 UTSW 5 73294351 splice site probably null
R3157:Ociad1 UTSW 5 73310345 nonsense probably null
R3159:Ociad1 UTSW 5 73310345 nonsense probably null
R4686:Ociad1 UTSW 5 73306735 missense possibly damaging 0.77
R5002:Ociad1 UTSW 5 73310316 missense possibly damaging 0.82
R5398:Ociad1 UTSW 5 73310412 missense probably benign 0.00
R5483:Ociad1 UTSW 5 73294971 missense probably damaging 1.00
R7220:Ociad1 UTSW 5 73313466 missense probably benign 0.00
R7511:Ociad1 UTSW 5 73294995 missense not run
Predicted Primers PCR Primer
(F):5'- ATCTTGGAATGGTAGCAATAGTTTG -3'
(R):5'- TCAAATGTTGTGTGTTGCATCA -3'

Sequencing Primer
(F):5'- AAGGCATTTGCAAAATTTAGTCAC -3'
(R):5'- CTAAACGCAGGTCATCAGGCTTG -3'
Posted On2017-02-28