Incidental Mutation 'R5921:Adamts7'
ID461586
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5921 (G1)
Quality Score221
Status Validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90188694 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 623 (S623P)
Ref Sequence ENSEMBL: ENSMUSP00000129292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect probably benign
Transcript: ENSMUST00000113059
AA Change: S623P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: S623P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113060
AA Change: S623P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: S623P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144943
Predicted Effect probably benign
Transcript: ENSMUST00000147250
AA Change: S623P

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: S623P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167122
AA Change: S623P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: S623P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90174622 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4661:Adamts7 UTSW 9 90193330 missense probably benign 0.02
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90191804 intron probably null
R7110:Adamts7 UTSW 9 90193964 missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90185815 missense probably damaging 1.00
R7239:Adamts7 UTSW 9 90186557 splice site probably null
R7519:Adamts7 UTSW 9 90197079 missense probably benign 0.22
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATGGACCGCAGTGACATAGG -3'
(R):5'- TGTCTTAAAAGTCAGACAGCAGGG -3'

Sequencing Primer
(F):5'- GCAGTGACATAGGACCCTCAG -3'
(R):5'- TGCAGCCTGGAGAAAGCC -3'
Posted On2017-02-28