Incidental Mutation 'R5921:Olfr284'
ID461601
Institutional Source Beutler Lab
Gene Symbol Olfr284
Ensembl Gene ENSMUSG00000051793
Gene Nameolfactory receptor 284
SynonymsMOR160-4, GA_x6K02T2NBG7-5395976-5396893
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98340022-98340987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98340429 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000145864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063289] [ENSMUST00000206647]
Predicted Effect probably benign
Transcript: ENSMUST00000063289
AA Change: T171A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065626
Gene: ENSMUSG00000051793
AA Change: T171A

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 5.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 259 1.3e-5 PFAM
Pfam:7tm_1 39 286 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206647
AA Change: T187A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Olfr284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr284 APN 15 98340173 missense possibly damaging 0.47
IGL02904:Olfr284 APN 15 98340848 missense probably null 0.88
PIT4378001:Olfr284 UTSW 15 98340272 missense possibly damaging 0.95
R0485:Olfr284 UTSW 15 98340929 missense probably benign 0.01
R1435:Olfr284 UTSW 15 98340328 missense possibly damaging 0.69
R4706:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R4707:Olfr284 UTSW 15 98340778 missense possibly damaging 0.62
R5272:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5314:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5315:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5316:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5317:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5456:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5458:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R5548:Olfr284 UTSW 15 98340372 missense probably benign 0.21
R5717:Olfr284 UTSW 15 98340365 missense probably benign 0.00
R6519:Olfr284 UTSW 15 98340048 missense probably benign 0.00
R6636:Olfr284 UTSW 15 98340950 missense probably benign 0.23
R7112:Olfr284 UTSW 15 98340540 missense possibly damaging 0.81
R7289:Olfr284 UTSW 15 98340062 missense probably damaging 1.00
R7392:Olfr284 UTSW 15 98340311 missense probably benign 0.03
R7403:Olfr284 UTSW 15 98340119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAAGGCCTTGCTTCTC -3'
(R):5'- TGAAAGCTGCTTGGCTCAG -3'

Sequencing Primer
(F):5'- GCTTCTCCCCGTGCTGG -3'
(R):5'- AGGCCTGTCTGCTTGCAG -3'
Posted On2017-02-28