Incidental Mutation 'R5922:Brinp2'
ID461615
Institutional Source Beutler Lab
Gene Symbol Brinp2
Ensembl Gene ENSMUSG00000004031
Gene Namebone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms6430517E21Rik, Fam5b
MMRRC Submission 043240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5922 (G1)
Quality Score208
Status Not validated
Chromosome1
Chromosomal Location158245269-158356326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158249355 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 390 (V390D)
Ref Sequence ENSEMBL: ENSMUSP00000004133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004133
AA Change: V390D

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031
AA Change: V390D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
MACPF 89 281 6.58e-50 SMART
Blast:MACPF 338 362 1e-5 BLAST
EGF 457 492 6.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195271
SMART Domains Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:MACPF 63 160 2.1e-6 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atr A G 9: 95,903,682 D1429G probably benign Het
Cpn1 T C 19: 43,986,093 S66G probably damaging Het
Dnal1 C A 12: 84,126,972 L55M probably damaging Het
Dus2 G A 8: 106,053,405 R453Q possibly damaging Het
Efcab5 T C 11: 77,188,744 T59A probably benign Het
Elmo1 A G 13: 20,605,169 D685G probably damaging Het
Ern1 T C 11: 106,421,730 E275G probably damaging Het
Etnk2 A G 1: 133,363,885 probably null Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Gjb2 A G 14: 57,100,298 M151T probably benign Het
Heatr9 C T 11: 83,512,367 probably null Het
Herpud2 G A 9: 25,108,984 L359F probably benign Het
Hpx C T 7: 105,595,624 R118H probably damaging Het
Hyal2 A G 9: 107,570,907 Y253C probably damaging Het
Igkv14-130 T C 6: 67,791,222 C22R probably damaging Het
Ms4a6b T A 19: 11,520,379 I14N possibly damaging Het
Myb T A 10: 21,152,927 I91F probably damaging Het
Myh6 C T 14: 54,946,474 D1668N probably damaging Het
Noc2l C T 4: 156,241,313 Q182* probably null Het
Nsd1 A G 13: 55,247,475 N1066S probably benign Het
Nup98 A G 7: 102,154,017 Y659H probably damaging Het
Nutm1 T C 2: 112,249,314 E752G possibly damaging Het
Paqr6 G T 3: 88,366,237 A154S probably benign Het
Pdlim7 G T 13: 55,508,955 T62K probably damaging Het
Pibf1 A G 14: 99,137,088 D321G probably benign Het
Plrg1 T A 3: 83,056,848 N29K possibly damaging Het
Scimp A C 11: 70,800,816 probably null Het
Sec16a T C 2: 26,415,639 N2251S probably benign Het
Sec61a2 A T 2: 5,874,323 D291E possibly damaging Het
Serpina3i A G 12: 104,266,507 K224E probably benign Het
Spz1 A T 13: 92,575,598 D123E possibly damaging Het
St14 A T 9: 31,129,904 probably benign Het
Ush1c A T 7: 46,204,128 probably null Het
Usp54 T C 14: 20,552,071 probably null Het
Zfhx3 C T 8: 108,946,698 T1460M probably damaging Het
Zfp712 G T 13: 67,041,604 N286K probably benign Het
Other mutations in Brinp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Brinp2 APN 1 158247100 missense probably benign 0.04
IGL01537:Brinp2 APN 1 158246809 missense probably damaging 1.00
IGL02354:Brinp2 APN 1 158247178 missense probably damaging 1.00
IGL02361:Brinp2 APN 1 158247178 missense probably damaging 1.00
R0334:Brinp2 UTSW 1 158295585 missense probably benign 0.06
R0652:Brinp2 UTSW 1 158246621 missense probably damaging 1.00
R1017:Brinp2 UTSW 1 158249451 missense probably damaging 0.99
R1141:Brinp2 UTSW 1 158247270 missense probably damaging 0.99
R1378:Brinp2 UTSW 1 158247054 missense possibly damaging 0.82
R1666:Brinp2 UTSW 1 158246558 missense probably damaging 1.00
R1892:Brinp2 UTSW 1 158254972 critical splice donor site probably null
R1986:Brinp2 UTSW 1 158246778 missense probably damaging 1.00
R3876:Brinp2 UTSW 1 158246846 missense probably damaging 0.99
R3924:Brinp2 UTSW 1 158246208 missense probably damaging 1.00
R4582:Brinp2 UTSW 1 158267938 missense probably damaging 1.00
R5239:Brinp2 UTSW 1 158251338 missense probably benign 0.00
R5537:Brinp2 UTSW 1 158255013 missense probably damaging 0.97
R5582:Brinp2 UTSW 1 158249409 missense probably damaging 1.00
R5762:Brinp2 UTSW 1 158246586 missense probably benign
R6746:Brinp2 UTSW 1 158266590 missense probably benign
R6999:Brinp2 UTSW 1 158251305 missense probably benign 0.20
R7144:Brinp2 UTSW 1 158295424 critical splice donor site probably null
R7221:Brinp2 UTSW 1 158266547 missense possibly damaging 0.90
R7376:Brinp2 UTSW 1 158251368 missense probably damaging 0.98
R7381:Brinp2 UTSW 1 158246343 missense probably benign 0.11
R7388:Brinp2 UTSW 1 158255009 missense probably damaging 1.00
R7531:Brinp2 UTSW 1 158266572 missense not run
X0024:Brinp2 UTSW 1 158267983 nonsense probably null
Z1088:Brinp2 UTSW 1 158246989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCTGCAGGTCCAGAATGAC -3'
(R):5'- GACTACATAGCTTCGCTCTGC -3'

Sequencing Primer
(F):5'- AGAATGACTGAATGGGTCACC -3'
(R):5'- ACATAGCTTCGCTCTGCTCAGAC -3'
Posted On2017-02-28