Incidental Mutation 'R5922:Efcab5'
ID461640
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene NameEF-hand calcium binding domain 5
Synonyms4930563A03Rik
MMRRC Submission 043240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5922 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77089915-77188968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77188744 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 59 (T59A)
Ref Sequence ENSEMBL: ENSMUSP00000104037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400]
Predicted Effect probably benign
Transcript: ENSMUST00000108400
AA Change: T59A

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: T59A

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atr A G 9: 95,903,682 D1429G probably benign Het
Brinp2 A T 1: 158,249,355 V390D possibly damaging Het
Cpn1 T C 19: 43,986,093 S66G probably damaging Het
Dnal1 C A 12: 84,126,972 L55M probably damaging Het
Dus2 G A 8: 106,053,405 R453Q possibly damaging Het
Elmo1 A G 13: 20,605,169 D685G probably damaging Het
Ern1 T C 11: 106,421,730 E275G probably damaging Het
Etnk2 A G 1: 133,363,885 probably null Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Gjb2 A G 14: 57,100,298 M151T probably benign Het
Heatr9 C T 11: 83,512,367 probably null Het
Herpud2 G A 9: 25,108,984 L359F probably benign Het
Hpx C T 7: 105,595,624 R118H probably damaging Het
Hyal2 A G 9: 107,570,907 Y253C probably damaging Het
Igkv14-130 T C 6: 67,791,222 C22R probably damaging Het
Ms4a6b T A 19: 11,520,379 I14N possibly damaging Het
Myb T A 10: 21,152,927 I91F probably damaging Het
Myh6 C T 14: 54,946,474 D1668N probably damaging Het
Noc2l C T 4: 156,241,313 Q182* probably null Het
Nsd1 A G 13: 55,247,475 N1066S probably benign Het
Nup98 A G 7: 102,154,017 Y659H probably damaging Het
Nutm1 T C 2: 112,249,314 E752G possibly damaging Het
Paqr6 G T 3: 88,366,237 A154S probably benign Het
Pdlim7 G T 13: 55,508,955 T62K probably damaging Het
Pibf1 A G 14: 99,137,088 D321G probably benign Het
Plrg1 T A 3: 83,056,848 N29K possibly damaging Het
Scimp A C 11: 70,800,816 probably null Het
Sec16a T C 2: 26,415,639 N2251S probably benign Het
Sec61a2 A T 2: 5,874,323 D291E possibly damaging Het
Serpina3i A G 12: 104,266,507 K224E probably benign Het
Spz1 A T 13: 92,575,598 D123E possibly damaging Het
St14 A T 9: 31,129,904 probably benign Het
Ush1c A T 7: 46,204,128 probably null Het
Usp54 T C 14: 20,552,071 probably null Het
Zfhx3 C T 8: 108,946,698 T1460M probably damaging Het
Zfp712 G T 13: 67,041,604 N286K probably benign Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTCAAGTGCCAGGATCAC -3'
(R):5'- TTCCCGGAGTGGAGCAAATG -3'

Sequencing Primer
(F):5'- TCAAGTGCCAGGATCACCAGTG -3'
(R):5'- TGCTGATGCAGGTGGAGAAG -3'
Posted On2017-02-28