Incidental Mutation 'R5923:Nup188'
ID 461666
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Name nucleoporin 188
Synonyms
MMRRC Submission 043241-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R5923 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 30176419-30234278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30194102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 136 (I136V)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447] [ENSMUST00000113634] [ENSMUST00000138666] [ENSMUST00000148969]
AlphaFold Q6ZQH8
Predicted Effect probably benign
Transcript: ENSMUST00000064447
AA Change: I136V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: I136V

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113634
SMART Domains Protein: ENSMUSP00000109264
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 128 1.2e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect probably benign
Transcript: ENSMUST00000138666
SMART Domains Protein: ENSMUSP00000122398
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 118 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141035
Predicted Effect probably benign
Transcript: ENSMUST00000143119
SMART Domains Protein: ENSMUSP00000125607
Gene: ENSMUSG00000098794

DomainStartEndE-ValueType
PDB:3OBZ|A 1 31 4e-9 PDB
Pfam:Nup188 47 126 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156023
Predicted Effect probably benign
Transcript: ENSMUST00000148969
SMART Domains Protein: ENSMUSP00000121742
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 115 1.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T G 10: 120,614,675 (GRCm39) probably benign Het
Abca9 A G 11: 110,051,378 (GRCm39) V106A probably benign Het
Arnt2 G T 7: 83,911,741 (GRCm39) T577K probably benign Het
Bod1l G A 5: 41,974,762 (GRCm39) T2184I probably damaging Het
Brpf3 G A 17: 29,025,610 (GRCm39) V228I possibly damaging Het
Cacna1d T C 14: 29,833,105 (GRCm39) N890S probably damaging Het
Cacna1s T A 1: 136,004,560 (GRCm39) M120K possibly damaging Het
Cdr2 A G 7: 120,581,224 (GRCm39) Y18H probably damaging Het
Cilp2 A G 8: 70,335,525 (GRCm39) F491S probably damaging Het
Cubn A T 2: 13,490,889 (GRCm39) S185T possibly damaging Het
Dst T C 1: 34,220,840 (GRCm39) S2215P probably benign Het
Echdc3 A G 2: 6,194,383 (GRCm39) V224A possibly damaging Het
Hivep3 G T 4: 119,953,490 (GRCm39) S602I possibly damaging Het
Itga2 T C 13: 115,021,055 (GRCm39) S99G probably benign Het
Kat6a A G 8: 23,429,495 (GRCm39) T1617A probably benign Het
Map1b T C 13: 99,569,661 (GRCm39) E1020G unknown Het
Nbeal1 T C 1: 60,287,554 (GRCm39) F933L probably damaging Het
Ntrk3 A T 7: 78,101,676 (GRCm39) I419N possibly damaging Het
Or8b38 T A 9: 37,973,154 (GRCm39) D179E probably benign Het
Plcb4 A T 2: 135,803,734 (GRCm39) K536* probably null Het
Polk A T 13: 96,631,923 (GRCm39) I270N probably damaging Het
Prl6a1 A T 13: 27,500,346 (GRCm39) M106L probably benign Het
Scap G T 9: 110,212,648 (GRCm39) D1027Y probably damaging Het
Spg11 A T 2: 121,923,959 (GRCm39) H787Q probably damaging Het
Tatdn3 T C 1: 190,781,507 (GRCm39) D215G probably damaging Het
Tbcd G A 11: 121,470,978 (GRCm39) C665Y probably benign Het
Tmc8 C T 11: 117,674,638 (GRCm39) R118C probably damaging Het
Ttn T A 2: 76,642,901 (GRCm39) H13245L probably damaging Het
Unc79 T C 12: 103,078,727 (GRCm39) S1631P probably damaging Het
Vmn1r12 G A 6: 57,136,020 (GRCm39) G39D probably benign Het
Vmn2r24 A G 6: 123,792,751 (GRCm39) S693G probably damaging Het
Zc3h3 G T 15: 75,657,413 (GRCm39) R593S probably damaging Het
Zfp598 T C 17: 24,896,523 (GRCm39) L200P probably damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30,223,412 (GRCm39) missense probably damaging 0.98
IGL01599:Nup188 APN 2 30,217,537 (GRCm39) missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30,219,371 (GRCm39) missense probably benign
IGL01973:Nup188 APN 2 30,229,862 (GRCm39) missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30,219,385 (GRCm39) nonsense probably null
IGL02221:Nup188 APN 2 30,220,653 (GRCm39) missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30,216,523 (GRCm39) missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30,213,648 (GRCm39) critical splice donor site probably null
IGL02986:Nup188 APN 2 30,197,645 (GRCm39) splice site probably null
IGL03029:Nup188 APN 2 30,212,592 (GRCm39) splice site probably benign
IGL03194:Nup188 APN 2 30,194,346 (GRCm39) missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30,230,653 (GRCm39) missense possibly damaging 0.52
core UTSW 2 30,229,906 (GRCm39) missense probably damaging 1.00
kern UTSW 2 30,227,045 (GRCm39) missense possibly damaging 0.94
P0027:Nup188 UTSW 2 30,212,693 (GRCm39) missense probably damaging 0.99
R0006:Nup188 UTSW 2 30,212,035 (GRCm39) missense probably benign 0.27
R0360:Nup188 UTSW 2 30,216,491 (GRCm39) missense probably null 0.93
R0373:Nup188 UTSW 2 30,221,000 (GRCm39) missense probably damaging 1.00
R0645:Nup188 UTSW 2 30,233,478 (GRCm39) splice site probably null
R1411:Nup188 UTSW 2 30,233,807 (GRCm39) missense probably benign 0.01
R1670:Nup188 UTSW 2 30,230,667 (GRCm39) missense probably benign 0.19
R2034:Nup188 UTSW 2 30,200,097 (GRCm39) unclassified probably benign
R2113:Nup188 UTSW 2 30,194,113 (GRCm39) nonsense probably null
R2142:Nup188 UTSW 2 30,226,718 (GRCm39) missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30,226,936 (GRCm39) splice site probably benign
R2567:Nup188 UTSW 2 30,231,794 (GRCm39) missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30,215,358 (GRCm39) missense probably damaging 0.98
R4006:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4007:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4079:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4480:Nup188 UTSW 2 30,212,141 (GRCm39) intron probably benign
R4628:Nup188 UTSW 2 30,219,358 (GRCm39) missense probably damaging 1.00
R4687:Nup188 UTSW 2 30,220,645 (GRCm39) missense probably benign 0.01
R4814:Nup188 UTSW 2 30,216,523 (GRCm39) missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30,229,596 (GRCm39) missense probably damaging 1.00
R5038:Nup188 UTSW 2 30,199,232 (GRCm39) missense probably damaging 0.98
R5056:Nup188 UTSW 2 30,194,143 (GRCm39) missense probably damaging 0.98
R5124:Nup188 UTSW 2 30,220,947 (GRCm39) missense probably damaging 1.00
R5256:Nup188 UTSW 2 30,220,761 (GRCm39) missense probably damaging 1.00
R5284:Nup188 UTSW 2 30,220,647 (GRCm39) missense probably damaging 1.00
R5548:Nup188 UTSW 2 30,216,505 (GRCm39) missense probably damaging 0.99
R5560:Nup188 UTSW 2 30,199,897 (GRCm39) missense probably damaging 0.99
R5668:Nup188 UTSW 2 30,226,336 (GRCm39) missense probably damaging 1.00
R5769:Nup188 UTSW 2 30,220,747 (GRCm39) missense probably benign 0.34
R5773:Nup188 UTSW 2 30,212,208 (GRCm39) missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30,191,060 (GRCm39) missense probably damaging 1.00
R5827:Nup188 UTSW 2 30,229,859 (GRCm39) missense probably damaging 1.00
R5919:Nup188 UTSW 2 30,229,906 (GRCm39) missense probably damaging 1.00
R6185:Nup188 UTSW 2 30,231,722 (GRCm39) missense probably damaging 0.97
R6457:Nup188 UTSW 2 30,212,199 (GRCm39) missense probably damaging 0.98
R6529:Nup188 UTSW 2 30,216,466 (GRCm39) missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30,213,580 (GRCm39) missense probably damaging 0.99
R7195:Nup188 UTSW 2 30,231,842 (GRCm39) critical splice donor site probably null
R7214:Nup188 UTSW 2 30,197,566 (GRCm39) missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30,230,613 (GRCm39) missense probably benign 0.09
R7853:Nup188 UTSW 2 30,213,575 (GRCm39) missense possibly damaging 0.95
R7998:Nup188 UTSW 2 30,220,983 (GRCm39) missense probably damaging 1.00
R8012:Nup188 UTSW 2 30,227,277 (GRCm39) missense possibly damaging 0.95
R8080:Nup188 UTSW 2 30,227,045 (GRCm39) missense possibly damaging 0.94
R8804:Nup188 UTSW 2 30,220,891 (GRCm39) missense probably benign
R8850:Nup188 UTSW 2 30,217,576 (GRCm39) missense probably damaging 0.99
R9110:Nup188 UTSW 2 30,222,461 (GRCm39) missense possibly damaging 0.94
R9157:Nup188 UTSW 2 30,188,456 (GRCm39) missense probably benign 0.02
R9209:Nup188 UTSW 2 30,232,397 (GRCm39) missense probably benign 0.02
R9287:Nup188 UTSW 2 30,226,726 (GRCm39) missense probably damaging 0.99
R9325:Nup188 UTSW 2 30,212,271 (GRCm39) missense probably damaging 0.99
R9390:Nup188 UTSW 2 30,220,777 (GRCm39) critical splice donor site probably null
R9607:Nup188 UTSW 2 30,197,724 (GRCm39) missense probably benign 0.01
R9746:Nup188 UTSW 2 30,194,300 (GRCm39) missense probably damaging 0.99
R9768:Nup188 UTSW 2 30,227,045 (GRCm39) missense probably damaging 0.99
T0722:Nup188 UTSW 2 30,212,693 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTTCCTTGGCATATGATTGTGG -3'
(R):5'- CACAGTCAGCATATTCCGCC -3'

Sequencing Primer
(F):5'- TAGGCACCTGTACACATGTG -3'
(R):5'- GTCAGCATATTCCGCCTTAAATATC -3'
Posted On 2017-02-28