Mutagenetix > Incidental Mutation

Incidental Mutation 'R5923:Itga2'

461692

Institutional Source

Beutler Lab

Gene Symbol

Itga2

Ensembl Gene

ENSMUSG00000015533

Gene Name

integrin alpha 2

Synonyms

DX5, VLA-2 receptor, alpha 2 subunit, CD49B

MMRRC Submission

043241-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5923 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114969617-115068636 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115021055 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 99 (S99G)

Ref Sequence

ENSEMBL: ENSMUSP00000053891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056117] [ENSMUST00000224204]

AlphaFold

Q62469

Predicted Effect

probably benign
Transcript: ENSMUST00000056117
AA Change: S99G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: S99G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Int_alpha	41	96	4.91e-4	SMART
VWA	169	359	2.42e-39	SMART
Blast:VWA	364	424	4e-26	BLAST
Int_alpha	430	481	2.59e-3	SMART
Int_alpha	484	541	3.5e-9	SMART
Int_alpha	547	602	3.11e-15	SMART
Int_alpha	611	669	2.52e-1	SMART
low complexity region	890	910	N/A	INTRINSIC
transmembrane domain	1129	1151	N/A	INTRINSIC
Pfam:Integrin_alpha	1152	1166	9e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224204
AA Change: S82G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.3%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513I03Rik	T	G	10: 120,614,675 (GRCm39)		probably benign	Het
Abca9	A	G	11: 110,051,378 (GRCm39)	V106A	probably benign	Het
Arnt2	G	T	7: 83,911,741 (GRCm39)	T577K	probably benign	Het
Bod1l	G	A	5: 41,974,762 (GRCm39)	T2184I	probably damaging	Het
Brpf3	G	A	17: 29,025,610 (GRCm39)	V228I	possibly damaging	Het
Cacna1d	T	C	14: 29,833,105 (GRCm39)	N890S	probably damaging	Het
Cacna1s	T	A	1: 136,004,560 (GRCm39)	M120K	possibly damaging	Het
Cdr2	A	G	7: 120,581,224 (GRCm39)	Y18H	probably damaging	Het
Cilp2	A	G	8: 70,335,525 (GRCm39)	F491S	probably damaging	Het
Cubn	A	T	2: 13,490,889 (GRCm39)	S185T	possibly damaging	Het
Dst	T	C	1: 34,220,840 (GRCm39)	S2215P	probably benign	Het
Echdc3	A	G	2: 6,194,383 (GRCm39)	V224A	possibly damaging	Het
Hivep3	G	T	4: 119,953,490 (GRCm39)	S602I	possibly damaging	Het
Kat6a	A	G	8: 23,429,495 (GRCm39)	T1617A	probably benign	Het
Map1b	T	C	13: 99,569,661 (GRCm39)	E1020G	unknown	Het
Nbeal1	T	C	1: 60,287,554 (GRCm39)	F933L	probably damaging	Het
Ntrk3	A	T	7: 78,101,676 (GRCm39)	I419N	possibly damaging	Het
Nup188	A	G	2: 30,194,102 (GRCm39)	I136V	probably benign	Het
Or8b38	T	A	9: 37,973,154 (GRCm39)	D179E	probably benign	Het
Plcb4	A	T	2: 135,803,734 (GRCm39)	K536*	probably null	Het
Polk	A	T	13: 96,631,923 (GRCm39)	I270N	probably damaging	Het
Prl6a1	A	T	13: 27,500,346 (GRCm39)	M106L	probably benign	Het
Scap	G	T	9: 110,212,648 (GRCm39)	D1027Y	probably damaging	Het
Spg11	A	T	2: 121,923,959 (GRCm39)	H787Q	probably damaging	Het
Tatdn3	T	C	1: 190,781,507 (GRCm39)	D215G	probably damaging	Het
Tbcd	G	A	11: 121,470,978 (GRCm39)	C665Y	probably benign	Het
Tmc8	C	T	11: 117,674,638 (GRCm39)	R118C	probably damaging	Het
Ttn	T	A	2: 76,642,901 (GRCm39)	H13245L	probably damaging	Het
Unc79	T	C	12: 103,078,727 (GRCm39)	S1631P	probably damaging	Het
Vmn1r12	G	A	6: 57,136,020 (GRCm39)	G39D	probably benign	Het
Vmn2r24	A	G	6: 123,792,751 (GRCm39)	S693G	probably damaging	Het
Zc3h3	G	T	15: 75,657,413 (GRCm39)	R593S	probably damaging	Het
Zfp598	T	C	17: 24,896,523 (GRCm39)	L200P	probably damaging	Het

Other mutations in Itga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00809:Itga2	APN	13	115,014,161 (GRCm39)	missense	probably damaging	0.99
IGL01481:Itga2	APN	13	114,996,168 (GRCm39)	missense	possibly damaging	0.63
IGL01666:Itga2	APN	13	114,973,627 (GRCm39)	critical splice donor site	probably null
IGL01730:Itga2	APN	13	114,990,947 (GRCm39)	splice site	probably benign
IGL01965:Itga2	APN	13	114,984,600 (GRCm39)	splice site	probably benign
IGL01987:Itga2	APN	13	114,984,482 (GRCm39)	nonsense	probably null
IGL02334:Itga2	APN	13	115,001,845 (GRCm39)	critical splice donor site	probably null
IGL02381:Itga2	APN	13	114,993,258 (GRCm39)	missense	probably damaging	1.00
IGL02562:Itga2	APN	13	114,973,106 (GRCm39)	unclassified	probably benign
IGL03191:Itga2	APN	13	114,973,020 (GRCm39)	unclassified	probably benign
IGL03209:Itga2	APN	13	115,017,168 (GRCm39)	missense	probably damaging	1.00
P0007:Itga2	UTSW	13	115,002,735 (GRCm39)	missense	probably damaging	1.00
R0023:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0023:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0025:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0029:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0062:Itga2	UTSW	13	115,007,032 (GRCm39)	missense	possibly damaging	0.90
R0149:Itga2	UTSW	13	114,973,115 (GRCm39)	unclassified	probably benign
R0152:Itga2	UTSW	13	115,002,850 (GRCm39)	missense	probably benign	0.06
R0496:Itga2	UTSW	13	114,990,435 (GRCm39)	missense	probably benign	0.00
R0502:Itga2	UTSW	13	114,982,392 (GRCm39)	missense	probably benign	0.15
R0599:Itga2	UTSW	13	114,993,186 (GRCm39)	splice site	probably benign
R0688:Itga2	UTSW	13	114,976,090 (GRCm39)	missense	probably benign	0.00
R0704:Itga2	UTSW	13	114,998,911 (GRCm39)	missense	possibly damaging	0.91
R0760:Itga2	UTSW	13	114,996,168 (GRCm39)	missense	possibly damaging	0.63
R0811:Itga2	UTSW	13	115,007,150 (GRCm39)	missense	possibly damaging	0.92
R0812:Itga2	UTSW	13	115,007,150 (GRCm39)	missense	possibly damaging	0.92
R0836:Itga2	UTSW	13	114,993,215 (GRCm39)	missense	probably damaging	0.99
R1196:Itga2	UTSW	13	115,002,691 (GRCm39)	critical splice donor site	probably null
R1546:Itga2	UTSW	13	114,985,956 (GRCm39)	missense	possibly damaging	0.63
R1639:Itga2	UTSW	13	114,993,832 (GRCm39)	missense	probably benign	0.00
R1834:Itga2	UTSW	13	114,993,263 (GRCm39)	missense	probably damaging	1.00
R1834:Itga2	UTSW	13	114,993,262 (GRCm39)	missense	probably damaging	0.98
R2180:Itga2	UTSW	13	114,985,917 (GRCm39)	missense	possibly damaging	0.67
R2190:Itga2	UTSW	13	115,007,141 (GRCm39)	missense	probably benign	0.05
R2518:Itga2	UTSW	13	115,017,578 (GRCm39)	missense	probably damaging	1.00
R3885:Itga2	UTSW	13	115,005,835 (GRCm39)	missense	probably benign	0.35
R3962:Itga2	UTSW	13	114,976,054 (GRCm39)	missense	probably damaging	0.99
R4094:Itga2	UTSW	13	115,007,161 (GRCm39)	missense	probably benign	0.01
R4193:Itga2	UTSW	13	115,023,185 (GRCm39)	nonsense	probably null
R4290:Itga2	UTSW	13	115,002,709 (GRCm39)	missense	probably damaging	0.98
R4459:Itga2	UTSW	13	114,980,019 (GRCm39)	missense	probably damaging	0.97
R4460:Itga2	UTSW	13	114,980,019 (GRCm39)	missense	probably damaging	0.97
R4628:Itga2	UTSW	13	115,014,229 (GRCm39)	missense	probably benign	0.03
R4655:Itga2	UTSW	13	115,009,805 (GRCm39)	missense	probably benign	0.00
R4716:Itga2	UTSW	13	114,993,909 (GRCm39)	missense	probably damaging	0.98
R4896:Itga2	UTSW	13	114,990,302 (GRCm39)	nonsense	probably null
R5093:Itga2	UTSW	13	114,992,717 (GRCm39)	missense	probably benign	0.00
R5488:Itga2	UTSW	13	114,979,971 (GRCm39)	missense	probably damaging	1.00
R5489:Itga2	UTSW	13	114,979,971 (GRCm39)	missense	probably damaging	1.00
R5743:Itga2	UTSW	13	115,021,042 (GRCm39)	missense	probably damaging	1.00
R5767:Itga2	UTSW	13	114,976,106 (GRCm39)	missense	possibly damaging	0.88
R5790:Itga2	UTSW	13	115,004,742 (GRCm39)	missense	probably benign	0.02
R6163:Itga2	UTSW	13	115,002,726 (GRCm39)	missense	probably damaging	1.00
R6227:Itga2	UTSW	13	114,976,097 (GRCm39)	missense	probably benign	0.30
R6278:Itga2	UTSW	13	114,982,424 (GRCm39)	missense	probably benign	0.05
R6283:Itga2	UTSW	13	115,005,786 (GRCm39)	missense	probably damaging	1.00
R6332:Itga2	UTSW	13	114,980,009 (GRCm39)	missense	probably benign
R6510:Itga2	UTSW	13	115,009,816 (GRCm39)	missense	probably damaging	1.00
R6742:Itga2	UTSW	13	114,973,061 (GRCm39)	missense	possibly damaging	0.93
R6869:Itga2	UTSW	13	115,012,073 (GRCm39)	splice site	probably null
R7073:Itga2	UTSW	13	114,996,149 (GRCm39)	missense	probably damaging	1.00
R7111:Itga2	UTSW	13	115,037,066 (GRCm39)	missense	unknown
R7236:Itga2	UTSW	13	115,014,227 (GRCm39)	missense	probably benign
R7269:Itga2	UTSW	13	115,023,225 (GRCm39)	nonsense	probably null
R7296:Itga2	UTSW	13	114,993,930 (GRCm39)	splice site	probably null
R7350:Itga2	UTSW	13	114,973,738 (GRCm39)	missense	probably damaging	0.98
R7375:Itga2	UTSW	13	115,005,753 (GRCm39)	missense	probably benign	0.06
R7501:Itga2	UTSW	13	115,012,095 (GRCm39)	missense	probably damaging	1.00
R7687:Itga2	UTSW	13	115,002,796 (GRCm39)	missense	probably damaging	1.00
R7766:Itga2	UTSW	13	114,990,427 (GRCm39)	missense	probably benign
R7810:Itga2	UTSW	13	115,002,715 (GRCm39)	missense	probably benign	0.15
R8038:Itga2	UTSW	13	114,990,291 (GRCm39)	missense	probably damaging	1.00
R8948:Itga2	UTSW	13	115,009,866 (GRCm39)	missense	probably damaging	1.00
R9132:Itga2	UTSW	13	115,014,298 (GRCm39)	nonsense	probably null
R9153:Itga2	UTSW	13	115,001,941 (GRCm39)	missense	probably benign	0.00
R9159:Itga2	UTSW	13	115,014,298 (GRCm39)	nonsense	probably null
R9651:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
R9652:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
R9653:Itga2	UTSW	13	115,020,991 (GRCm39)	missense	probably benign	0.00
Z1088:Itga2	UTSW	13	114,993,868 (GRCm39)	missense	possibly damaging	0.46
Z1177:Itga2	UTSW	13	114,990,237 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAATAGCATAGTTGGTCCACAGG -3'
(R):5'- CCTTGAATGGCTGAAGGATCC -3'

Sequencing Primer
(F):5'- ATAGTTGGTCCACAGGCAACCTTC -3'
(R):5'- CTTGAATGGCTGAAGGATCCACATC -3'

Posted On

2017-02-28