Incidental Mutation 'R5925:Ehf'
ID461773
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Nameets homologous factor
Synonyms9030625L19Rik
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103263433-103303278 bp(-) (GRCm38)
Type of Mutationunclassified (83 bp from exon)
DNA Base Change (assembly) T to C at 103266993 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111174] [ENSMUST00000111176] [ENSMUST00000125788]
Predicted Effect silent
Transcript: ENSMUST00000090475
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect silent
Transcript: ENSMUST00000111174
SMART Domains Protein: ENSMUSP00000106805
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect silent
Transcript: ENSMUST00000111176
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125788
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137774
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103266840 unclassified probably null
IGL01296:Ehf APN 2 103268155 splice site probably null
IGL02095:Ehf APN 2 103266991 missense probably damaging 1.00
R0399:Ehf UTSW 2 103266870 missense probably damaging 1.00
R1116:Ehf UTSW 2 103267009 missense probably damaging 1.00
R1728:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R1729:Ehf UTSW 2 103273906 missense possibly damaging 0.51
R2240:Ehf UTSW 2 103274075 missense probably benign
R2287:Ehf UTSW 2 103267124 missense possibly damaging 0.89
R2397:Ehf UTSW 2 103276819 missense probably damaging 0.99
R4094:Ehf UTSW 2 103290750 intron probably benign
R4687:Ehf UTSW 2 103267126 missense probably damaging 1.00
R4930:Ehf UTSW 2 103266857 missense probably damaging 1.00
R5695:Ehf UTSW 2 103266779 missense probably damaging 1.00
R6656:Ehf UTSW 2 103283583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGACCAGCCGTCGTCCATC -3'
(R):5'- AGGCTGTCACTCCACATTCG -3'

Sequencing Primer
(F):5'- GTCCATCCACACGTTCCAGG -3'
(R):5'- GCACCCTTGCTAAGCCATTGTG -3'
Posted On2017-02-28