Incidental Mutation 'R0566:Olfr456'
ID46181
Institutional Source Beutler Lab
Gene Symbol Olfr456
Ensembl Gene ENSMUSG00000090631
Gene Nameolfactory receptor 456
SynonymsGA_x6K02T2P3E9-5073878-5074816, MOR257-7P
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42486163-42487214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42487091 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 34 (Y34F)
Ref Sequence ENSEMBL: ENSMUSP00000060839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057251]
Predicted Effect probably damaging
Transcript: ENSMUST00000057251
AA Change: Y34F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060839
Gene: ENSMUSG00000090631
AA Change: Y34F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.7e-50 PFAM
Pfam:7tm_1 40 289 1.2e-22 PFAM
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Olfr456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02884:Olfr456 APN 6 42486606 missense probably damaging 0.97
R0066:Olfr456 UTSW 6 42486935 missense probably benign 0.00
R4801:Olfr456 UTSW 6 42486679 missense probably benign 0.02
R4802:Olfr456 UTSW 6 42486679 missense probably benign 0.02
R4867:Olfr456 UTSW 6 42487097 missense probably benign 0.00
R6052:Olfr456 UTSW 6 42486654 missense possibly damaging 0.94
R6967:Olfr456 UTSW 6 42487013 missense probably damaging 0.99
R7250:Olfr456 UTSW 6 42486755 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCGTAATGGATTACAGACAGCCACAG -3'
(R):5'- CAGACTATGTCCCAGCTCTAGTTCCAG -3'

Sequencing Primer
(F):5'- TCAGTTCCCCCAAGAGTCAG -3'
(R):5'- AGCTCTAGTTCCAGTCTTAACC -3'
Posted On2013-06-11