Incidental Mutation 'R5931:Vps4b'
ID461818
Institutional Source Beutler Lab
Gene Symbol Vps4b
Ensembl Gene ENSMUSG00000009907
Gene Namevacuolar protein sorting 4B
SynonymsSkd1, 8030489C12Rik
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106764071-106796728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106777335 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 343 (I343V)
Ref Sequence ENSEMBL: ENSMUSP00000108356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094646] [ENSMUST00000112736]
Predicted Effect probably benign
Transcript: ENSMUST00000094646
AA Change: I343V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092230
Gene: ENSMUSG00000009907
AA Change: I343V

DomainStartEndE-ValueType
MIT 4 82 7.95e-26 SMART
AAA 166 302 1.55e-22 SMART
Blast:AAA 322 366 3e-10 BLAST
Pfam:Vps4_C 381 441 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112736
AA Change: I343V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108356
Gene: ENSMUSG00000009907
AA Change: I343V

DomainStartEndE-ValueType
MIT 4 82 7.95e-26 SMART
AAA 166 302 1.55e-22 SMART
Blast:AAA 322 366 3e-10 BLAST
Pfam:Vps4_C 380 441 7.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190531
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. Mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be a yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 18; the gene for the other resides on chromosome 16. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Vps4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1484:Vps4b UTSW 1 106779982 missense probably damaging 1.00
R1843:Vps4b UTSW 1 106778982 missense possibly damaging 0.94
R5044:Vps4b UTSW 1 106796418 splice site probably null
R5375:Vps4b UTSW 1 106791692 missense probably benign 0.36
R7311:Vps4b UTSW 1 106791704 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTTGCACCAGAATGACTCAG -3'
(R):5'- TGTGCGCATGAACACTTAAG -3'

Sequencing Primer
(F):5'- TTGCACCAGAATGACTCAGAAATG -3'
(R):5'- GTGCGCATGAACACTTAAGTATGTG -3'
Posted On2017-02-28